NovoPro
Cart 2
  • MTCH2 Human  cDNA/ORF Clones

MTCH2 Human cDNA/ORF Clones

Cat.#: 708017-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 122.6 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    mitochondrial carrier 2
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    MTCH2
  • Gene Type
    protein coding
  • Also Known as
    MIMP; HSPC032; SLC25A50
  • Encoded Protein Alias
    mitochondrial carrier homolog 2; 2310034D24Rik; met-induced mitochondrial protein; solute carrier family 25, member 50
  • Product Name
    MTCH2(XM_017017463) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens mitochondrial carrier 2 (MTCH2), transcript variant X6, mRNA.
  • Synonyms
  • ORF length
    531
  • siRNA

    GGUAAAGUUUUACAGCAUUtt

    GAGCCGAGGAAAUAGCUUAtt

    CAACAAUAGGACGAAAUAUtt

  • DataSheet:
  • Product Name
    MTCH2(NM_001317232) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens mitochondrial carrier 2 (MTCH2), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    885
  • Annotation
    This variant (2) lacks an in-frame coding exon in the 5' region compared to variant 1. The resulting isoform (2) is shorter, missing an internal protein segment compared to isoform 1.
  • siRNA

    GAGCCGAGGAAAUAGCUUAtt

    CAACAAUAGGACGAAAUAUtt

  • DataSheet:
  • Product Name
    MTCH2(XM_011519960) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens mitochondrial carrier 2 (MTCH2), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    897
  • siRNA

    CAACAAUAGGACGAAAUAUtt

  • DataSheet:
  • Product Name
    MTCH2(NM_001317231) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens mitochondrial carrier 2 (MTCH2), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    945
  • Annotation
    This variant (1) represents the predominant transcript and encodes two isoforms, which result from the use of alternative in-frame translation termination codons. The shorter isoform (1) results from translation termination at the upstream UGA stop codon (nt 1099-1101), while the longer isoform (1x) results from UGA stop codon readthrough to the downstream UAG termination codon (nt 1132-1134). This RefSeq represents the longer, C-terminally extended isoform. As the UGA stop codon has been reported to specify several alternative amino acids (tryptophan, cysteine, arginine and serine), its location in the longer isoform is denoted by an 'X'.
  • siRNA

    GGUAAAGUUUUACAGCAUUtt

    GAGCCGAGGAAAUAGCUUAtt

    CAACAAUAGGACGAAAUAUtt

  • DataSheet:
  • Product Name
    MTCH2(XM_017017462) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens mitochondrial carrier 2 (MTCH2), transcript variant X5, mRNA.
  • Synonyms
  • ORF length
    753
  • siRNA

    GAGCCGAGGAAAUAGCUUAtt

    CAACAAUAGGACGAAAUAUtt

  • DataSheet:
  • Product Name
    MTCH2(XM_009246383) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens mitochondrial carrier 2 (MTCH2), transcript variant X4, mRNA.
  • Synonyms
  • ORF length
    780
  • siRNA
  • DataSheet:
  • Product Name
    MTCH2(NM_001317233) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens mitochondrial carrier 2 (MTCH2), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    468
  • Annotation
    This variant (3) lacks an exon in the 5' region, which results in translation initiation from an in-frame, downstream start codon compared to variant 1. The encoded isoform (3) has a shorter N-terminus compared to isoform 1.
  • siRNA

    GGUAAAGUUUUACAGCAUUtt

    GAGCCGAGGAAAUAGCUUAtt

    CAACAAUAGGACGAAAUAUtt

  • DataSheet:
  • Product Name
    MTCH2(XM_011519959) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens mitochondrial carrier 2 (MTCH2), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    924
  • siRNA

    GGUAAAGUUUUACAGCAUUtt

    CAACAAUAGGACGAAAUAUtt

  • DataSheet:
  • Product Name
    MTCH2(XM_011519961) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens mitochondrial carrier 2 (MTCH2), transcript variant X3, mRNA.
  • Synonyms
  • ORF length
    813
  • siRNA

    GGUAAAGUUUUACAGCAUUtt

    CAACAAUAGGACGAAAUAUtt

  • DataSheet:
  • Product Name
    MTCH2(NM_014342) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens mitochondrial carrier 2 (MTCH2), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    912
  • Annotation
    This variant (1) represents the predominant transcript and encodes two isoforms, which result from the use of alternative in-frame translation termination codons. The shorter isoform (1) results from translation termination at the upstream UGA stop codon (nt 1099-1101), while the longer isoform (1x) results from UGA stop codon readthrough to the downstream UAG termination codon (nt 1132-1134). This RefSeq represents the shorter isoform.
  • siRNA

    GGUAAAGUUUUACAGCAUUtt

    GAGCCGAGGAAAUAGCUUAtt

    CAACAAUAGGACGAAAUAUtt

  • DataSheet:
  • DataSheet:
  • DataSheet:
  • Vector Name
    pCMV-SPORT6
  • primers
    T7: TAATACGACTCACTATAGGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4396
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    Vector for cloning and transient mammalian cell expression of cDNAs.
  • Vector Name
    pGEM-T
  • primers
    T7: TAATACGACTCACTATAGGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    3000
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    The pGEM-T is 3kb in length, and contains the amplicin resistance gene, conferring selection of the plasmid in E. coli, and the ori site which is the bacterial origin of replication. The plasmid has multiple cloning sites as shown below. The coding sequence was inserted by TA cloning. Many E. coli strains are suitable for the propagation of this vector including JM109, DH5α and TOP10.
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"