NovoPro
Cart 2
  • Mtch2 Rat  cDNA/ORF Clones

Mtch2 Rat cDNA/ORF Clones

Cat.#: 701823-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 140.6 USD

Availability: In Stock
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    mitochondrial carrier 2
  • Organism
    Rat
  • Entrez Gene ID
  • Gene Symbol
    Mtch2
  • Gene Type
    protein coding
  • Also Known as
    Hspc032
  • Encoded Protein Alias
    mitochondrial carrier homolog 2
  • Product Name
    Mtch2(NM_001106488) Rat cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Rattus norvegicus mitochondrial carrier 2 (Mtch2), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    912
  • Annotation
    This variant (1) represents the predominant transcript and encodes two isoforms, which result from the use of alternative in-frame translation termination codons. The shorter isoform (1) results from translation termination at the upstream UGA stop codon (nt 991-993), while the longer isoform (1x) results from UGA stop codon readthrough to the downstream UAG termination codon (nt 1024-1026). This RefSeq represents the shorter isoform.
  • siRNA

    CCUUCCACGUGAUUACUCUtt

    CCUCCUAGGUGACAUCAUUtt

    CUUUGACCGAGUUAUCAAAtt

  • DataSheet:
  • Product Name
    Mtch2(NM_001317330) Rat cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Rattus norvegicus mitochondrial carrier 2 (Mtch2), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    945
  • Annotation
    This variant (1) represents the predominant transcript and encodes two isoforms, which result from the use of alternative in-frame translation termination codons. The shorter isoform (1) results from translation termination at the upstream UGA stop codon (nt 991-993), while the longer isoform (1x) results from UGA stop codon readthrough to the downstream UAG termination codon (nt 1024-1026). This RefSeq represents the longer, C-terminally extended isoform. As the UGA stop codon has been reported to specify several alternative amino acids (tryptophan, cysteine, arginine and serine), its location in the longer isoform is denoted by an 'X'.
  • siRNA
  • DataSheet:
  • Vector Name
    pUC19
  • primers
    M13 fwd: GTAAAACGACGGCCAGT
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    2686
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    pUC19 is a small, high-copy number E. coli plasmid cloning vector, of which multiple cloning sites as shown below. The molecule is a small double-stranded circle, 2686 base pairs in length. pUC19 encodes the N-terminal fragment of b-galactosidase (lacZa), which allows for blue/white colony screening (i.e., a-complementation), as well as a pUC origin of replication.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"