NovoPro
Cart 2
  • MAP1LC3C Human  cDNA/ORF Clones

MAP1LC3C Human cDNA/ORF Clones

Cat.#: 701184-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 257.6 USD

Availability: In Stock
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    microtubule associated protein 1 light chain 3 gamma
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    MAP1LC3C
  • Gene Type
    protein coding
  • Also Known as
    LC3C; ATG8J
  • Encoded Protein Alias
    microtubule-associated proteins 1A/1B light chain 3C; LC3-like protein 2; MAP1 light chain 3-like protein 2; MAP1 light chain 3-like protein 3; MAP1A/MAP1B LC3 C; MAP1A/MAP1B light chain 3 C; autophagy-related protein LC3 C; autophagy-related ubiquitin-like modifier LC3 C
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"