NovoPro
Cart 2
  • MDGA2 Human  cDNA/ORF Clones

MDGA2 Human cDNA/ORF Clones

Cat.#: 702910-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 271.0 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    MAM domain containing glycosylphosphatidylinositol anchor 2
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    MDGA2
  • Gene Type
    protein coding
  • Also Known as
    MAMDC1; c14_5286
  • Encoded Protein Alias
    MAM domain-containing glycosylphosphatidylinositol anchor protein 2; MAM domain containing 1
  • Product Name
    MDGA2(XM_017021061) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens MAM domain containing glycosylphosphatidylinositol anchor 2 (MDGA2), transcript variant X5, mRNA.
  • Synonyms
  • ORF length
    1581
  • siRNA

    GACCUUCGCGAGUUACUUUtt

  • DataSheet:
  • Product Name
    MDGA2(XM_017021060) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens MAM domain containing glycosylphosphatidylinositol anchor 2 (MDGA2), transcript variant X3, mRNA.
  • Synonyms
  • ORF length
    1716
  • siRNA

    GGACCUAAUGCUGACCGUAtt

    GGAUUGUUGCAUACCGGUUtt

    GGCAAUAAAUUAUUACGGAtt

  • DataSheet:
  • Product Name
    MDGA2(XM_011536525) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens MAM domain containing glycosylphosphatidylinositol anchor 2 (MDGA2), transcript variant X6, mRNA.
  • Synonyms
  • ORF length
    1551
  • siRNA

    GGACCUAAUGCUGACCGUAtt

    GGAUUGUUGCAUACCGGUUtt

    GGCAAUAAAUUAUUACGGAtt

  • DataSheet:
  • Product Name
    MDGA2(NM_182830) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens MAM domain containing glycosylphosphatidylinositol anchor 2 (MDGA2), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    2184
  • Annotation
    This variant (2) differs in the 5' UTR and has multiple 5' coding region differences, compared to variant 1. These differences cause translation initiation at a downstream AUG and an isoform (2) with a shorter N-terminus, compared to isoform 1.
  • siRNA

    GGACCUAAUGCUGACCGUAtt

    GGAUUGUUGCAUACCGGUUtt

    GGCAAUAAAUUAUUACGGAtt

  • DataSheet:
  • Product Name
    MDGA2(XM_011536522) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens MAM domain containing glycosylphosphatidylinositol anchor 2 (MDGA2), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    1866
  • siRNA

    GACCUUCGCGAGUUACUUUtt

  • DataSheet:
  • Product Name
    MDGA2(XM_011536519) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens MAM domain containing glycosylphosphatidylinositol anchor 2 (MDGA2), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    2943
  • siRNA

    GGACCUAAUGCUGACCGUAtt

    GGAUUGUUGCAUACCGGUUtt

    GGCAAUAAAUUAUUACGGAtt

  • DataSheet:
  • Product Name
    MDGA2(NM_001113498) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens MAM domain containing glycosylphosphatidylinositol anchor 2 (MDGA2), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    2871
  • Annotation
    This variant (1) represents the longest transcript and encodes the longest isoform (1).
  • siRNA

    GGACCUAAUGCUGACCGUAtt

    GGAUUGUUGCAUACCGGUUtt

    GGCAAUAAAUUAUUACGGAtt

  • DataSheet:
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pUC18c
  • primers
    M13 fwd: GTAAAACGACGGCCAGT
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    2693
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    pMD18-T Vector is a high-efficiency TA cloning vector constructed from pUC18, of which the initial multiple cloning sites (MCS) were destroyed. Thus the cDNA should be amplified by PCR with primers containing a restriction site for subclone. Competent cells appropriate for pUC18 are also appropriated for this Vector, e.g. JM109, DH5α, TOP10. The pMD18-T Simple Vector is 2.6kb in size. Selection of the plasmid in E. coli is conferred by the ampicillin resistance gene. The coding sequence was inserted by TA cloning at site 425.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.
  • Antibodies
  • Recombinant Proteins
  • cDNA Clones

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"