NovoPro
Cart 2
  • Lypd3 Rat  cDNA/ORF Clones

Lypd3 Rat cDNA/ORF Clones

Cat.#: 746372-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 181.5 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    Ly6/Plaur domain containing 3
  • Organism
    Rat
  • Entrez Gene ID
  • Gene Symbol
    Lypd3
  • Gene Type
    protein coding
  • Also Known as
    C4.4a
  • Encoded Protein Alias
    GPI-anchored metastasis-associated protein C4.4A; GPI-anchored metastasis-associated protein homolog; metastasis-associated GPI-anchored protein; metastasis-associated molecule
  • Product Name
    Lypd3(NM_021759) Rat cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Rattus norvegicus Ly6/Plaur domain containing 3 (Lypd3), mRNA.
  • Synonyms
  • ORF length
    1059
  • siRNA

    CUUCAACCCAUGAAACAGAtt

    AGCACGAGGUCAUACAGGAtt

    GAGCCCAAAUCCCAUCUAAtt

    GGAUGCUCUCCGCACAAGAtt

    CGCCUGUCGUGAAUUGCUAtt

  • DataSheet:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"