NovoPro
Cart 2
  • LTB Human  cDNA/ORF Clones

LTB Human cDNA/ORF Clones

Cat.#: 713389-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 140.6 USD

Availability: In Stock
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    lymphotoxin beta
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    LTB
  • Gene Type
    protein coding
  • Also Known as
    p33; TNFC; TNFSF3; TNLG1C
  • Encoded Protein Alias
    lymphotoxin-beta; LT-beta; TNF-C; tumor necrosis factor C; tumor necrosis factor ligand superfamily member 3
  • Product Name
    LTB(NM_009588) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens lymphotoxin beta (LTB), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    234
  • Annotation
    This splice variant (2) lacks an exon in the coding region, compared to variant 1. The encoded protein (isoform b) has a premature stop codon and lacks the majority of the extracellular domain, compared to isoform a. This loss impairs its ability to complex with lympytoxin-alpha.
  • siRNA

    GACGGCCUCUAUUACCUCUtt

    AUUUUGAACCUGAUGAAAAtt

    GUGGGAAAAAUGUAGGAGAtt

  • DataSheet:
  • Product Name
    LTB(NM_002341) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens lymphotoxin beta (LTB), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    735
  • Annotation
    This splice variant (1) represents the longer transcript, encodes the longer isoform (a), and can form the heterotrimeric complex with lymphotoxin-alpha.
  • siRNA

    GACGGCCUCUAUUACCUCUtt

    AUUUUGAACCUGAUGAAAAtt

    GUGGGAAAAAUGUAGGAGAtt

  • DataSheet:
  • Vector Name
    pGEM-T
  • primers
    T7: TAATACGACTCACTATAGGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    3000
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    The pGEM-T is 3kb in length, and contains the amplicin resistance gene, conferring selection of the plasmid in E. coli, and the ori site which is the bacterial origin of replication. The plasmid has multiple cloning sites as shown below. The coding sequence was inserted by TA cloning. Many E. coli strains are suitable for the propagation of this vector including JM109, DH5α and TOP10.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"