NovoPro
Cart 2
  • Kitlg Rat  cDNA/ORF Clones

Kitlg Rat cDNA/ORF Clones

Cat.#: 746363-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 126.5 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    KIT ligand
  • Organism
    Rat
  • Entrez Gene ID
  • Gene Symbol
    Kitlg
  • Gene Type
    protein coding
  • Also Known as
    Mgf; SCF; Kitl
  • Encoded Protein Alias
    C-kit ligand; hematopoietic growth factor KL; mast cell growth factor; steel factor/kit ligand; stem cell factor KL-1
  • Product Name
    Kitlg(NM_021844) Rat cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Rattus norvegicus KIT ligand (Kitlg), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    738
  • Annotation
    This variant (2) lacks an alternate in-frame segment in the 3' coding region, compared to variant 1. The resulting protein (isoform 2) is shorter when it is compared to isoform 1.
  • siRNA

    GCCUAGUCAUUGUUGGUUAtt

    CACCUAAGAAUGUAAAAGAtt

    GCCUUAUACUGGAAGAAGAtt

  • DataSheet:
  • Product Name
    Kitlg(NM_021843) Rat cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Rattus norvegicus KIT ligand (Kitlg), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    822
  • Annotation
    This variant (1) represents the longer transcript and it encodes the longer protein (isoform 1).
  • siRNA

    GCAGUAGCAGUAAUAGGAAtt

    GCCUAGUCAUUGUUGGUUAtt

    CACCUAAGAAUGUAAAAGAtt

    GCCUUAUACUGGAAGAAGAtt

  • DataSheet:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"