Cart 2
  • IL37 Human  cDNA/ORF Clone

IL37 Human cDNA/ORF Clone

Cat.#: 707846-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 122.6 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    interleukin 37
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    IL37
  • Gene Type
    protein coding
  • Also Known as
    FIL1; FIL1Z; IL-1H; IL-37; IL1F7; IL1H4; IL-1F7; IL-1H4; IL1RP1; IL-1RP1; FIL1(ZETA)
  • Encoded Protein Alias
    interleukin-37; FIL1 zeta; IL-1 zeta; IL-1F7b (IL-1H4, IL-1H, IL-1RP1); IL-1X protein; IL1F7 (canonical product IL-1F7b); interleukin 1 family member 7; interleukin 1, zeta; interleukin-1 homolog 4; interleukin-1 superfamily z; interleukin-1-related protein; interleukin-23
  • Product Name
    IL37(NM_173204) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens interleukin 37 (IL37), transcript variant 4, mRNA.
  • Synonyms
  • ORF length
    537
  • Annotation
    This variant (4) lacks an in-frame coding exon, compared to variant 1, resulting an isoform (4) that lacks an internal region, as compared to isoform 1.
  • siRNA

    CAAUUGUAAUGAGCCUGUUtt

    ACAGAUAAAUUUGAGAACAtt

    GCAUUAGCCUCAUCCUUGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    IL37(NM_173205) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens interleukin 37 (IL37), transcript variant 5, mRNA.
  • Synonyms
  • ORF length
    579
  • Annotation
    This variant (5) has an alternate 5' sequence, compared to variant 1. The resulting isoform (5) has a distinct and shorter N-terminus, as compared to isoform 1.
  • siRNA

    CAAUUGUAAUGAGCCUGUUtt

    ACAGAUAAAUUUGAGAACAtt

    GCAUUAGCCUCAUCCUUGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    IL37(NM_173202) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens interleukin 37 (IL37), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    594
  • Annotation
    This variant (2) lacks an in-frame coding exon, compared to variant 1, resulting an isoform (2) that lacks an internal region, as compared to isoform 1.
  • siRNA

    CAAUUGUAAUGAGCCUGUUtt

    ACAGAUAAAUUUGAGAACAtt

    GCAUUAGCCUCAUCCUUGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    IL37(NM_173203) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens interleukin 37 (IL37), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    474
  • Annotation
    This variant (3) lacks two consecutive exons but maintains the reading frame, compared to variant 1, resulting an isoform (3) that lacks an internal region, as compared to isoform 1.
  • siRNA

    CAAUUGUAAUGAGCCUGUUtt

    ACAGAUAAAUUUGAGAACAtt

    GCAUUAGCCUCAUCCUUGAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pEXP-Entry
  • primers
    T7: TAATACGACTCACTATAGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4919
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    Myc,FLAG
  • Description
    ORFs cloned in this vector will be expressed in mammalian cellsas a tagged protein with the C-terminal Myc-FLAG tags.
    Such clones are the best for detection and purification of the transgene using anti-Myc or anti-FLAG antibodies.
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"