NovoPro
Cart 2
  • Il2rb Rat  cDNA/ORF Clone

Il2rb Rat cDNA/ORF Clone

Cat.#: 708388-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 211.2 USD

Availability: In Stock
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    interleukin 2 receptor subunit beta
  • Organism
    Rat
  • Entrez Gene ID
  • Gene Symbol
    Il2rb
  • Gene Type
    protein coding
  • Also Known as
    IL2RBC
  • Encoded Protein Alias
    interleukin-2 receptor subunit beta; IL-2 receptor subunit beta; IL-2R subunit beta; IL-2RB; P70-75; high affinity IL-2 receptor subunit beta; interleukin 2 receptor, beta chain
  • Product Name
    Il2rb(NM_013195) Rat cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Rattus norvegicus interleukin 2 receptor subunit beta (Il2rb), mRNA.
  • Synonyms
  • ORF length
    1614
  • siRNA

    UCCUGACUCUAAACACUGAtt

    AGGUGAGGGUCAUAGCUCAtt

    GAAUAAAACCUGUGAGCUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    Il2rb(XM_006241970) Rat cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Rattus norvegicus interleukin 2 receptor subunit beta (Il2rb), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    1617
  • siRNA

    UCCUGACUCUAAACACUGAtt

    AGGUGAGGGUCAUAGCUCAtt

    GAAUAAAACCUGUGAGCUAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pGEM-T
  • primers
    T7: TAATACGACTCACTATAGGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    3000
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    The pGEM-T is 3kb in length, and contains the amplicin resistance gene, conferring selection of the plasmid in E. coli, and the ori site which is the bacterial origin of replication. The plasmid has multiple cloning sites as shown below. The coding sequence was inserted by TA cloning. Many E. coli strains are suitable for the propagation of this vector including JM109, DH5α and TOP10.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"