NovoPro
Cart 2
  • IL2RB Dog  cDNA/ORF Clone

IL2RB Dog cDNA/ORF Clone

Cat.#: 700945-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 285.9 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    interleukin 2 receptor subunit beta
  • Organism
    Dog
  • Entrez Gene ID
  • Gene Symbol
    IL2RB
  • Gene Type
    protein coding
  • Encoded Protein Alias
    interleukin-2 receptor subunit beta; IL 2/15 receptor beta chain
  • Product Name
    IL2RB(NM_001286850) Dog cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Canis lupus familiaris interleukin 2 receptor subunit beta (IL2RB), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    1668
  • Annotation
    This variant (2) uses an alternate in-frame splice site in the 5' coding region, compared to variant 1.
  • DataSheet:
  • FAQs:
  • Product Name
    IL2RB(NM_001286851) Dog cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Canis lupus familiaris interleukin 2 receptor subunit beta (IL2RB), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    1671
  • Annotation
    This variant (1) represents the longer transcript and encodes the longer isoform (1).
  • DataSheet:
  • FAQs:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"