NovoPro
Cart 2
  • IL1RN Human  cDNA/ORF Clones

IL1RN Human cDNA/ORF Clones

Cat.#: 713831-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 267.6 USD

Availability: In Stock
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    interleukin 1 receptor antagonist
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    IL1RN
  • Gene Type
    protein coding
  • Also Known as
    DIRA; IRAP; IL1F3; IL1RA; MVCD4; IL-1RN; IL-1ra; IL-1ra3; ICIL-1RA
  • Encoded Protein Alias
    interleukin-1 receptor antagonist protein; IL1 inhibitor; IL1RN (IL1F3); intracellular IL-1 receptor antagonist type II; intracellular interleukin-1 receptor antagonist (icIL-1ra); type II interleukin-1 receptor antagonist
  • Product Name
    IL1RN(NM_173841) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens interleukin 1 receptor antagonist (IL1RN), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    543
  • Annotation
    This variant (2) encodes the longest isoform (2).
  • siRNA

    AGGACCAAAUGUCAAUUUAtt

    GAAUCUGGGAUGUUAACCAtt

    AGAUAGAUGUGGUACCCAUtt

  • DataSheet:
  • Product Name
    IL1RN(NM_173842) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens interleukin 1 receptor antagonist (IL1RN), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    534
  • Annotation
    This variant (1) differs in the 5' end compared to variant 2, resulting in an isoform (1) that has a distinct and shorter N-terminus, as compared to the longest isoform (2).
  • siRNA

    AGGACCAAAUGUCAAUUUAtt

    GAAUCUGGGAUGUUAACCAtt

    AGAUAGAUGUGGUACCCAUtt

  • DataSheet:
  • DataSheet:
  • DataSheet:
  • Product Name
    IL1RN(NM_173843) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens interleukin 1 receptor antagonist (IL1RN), transcript variant 5, mRNA.
  • Synonyms
  • ORF length
    432
  • Annotation
    This variant (5) contains two alternate internal exons compared to variant 2. This results in translation from a downstream start codon, and an isoform (4) that has a shorter N-terminus, as compared to the longest isoform (2). Variants 4 and 5 both encode the same isoform (4).
  • siRNA

    AGGACCAAAUGUCAAUUUAtt

    GAAUCUGGGAUGUUAACCAtt

    AGAUAGAUGUGGUACCCAUtt

  • DataSheet:
  • DataSheet:
  • DataSheet:
  • Product Name
    IL1RN(NM_000577) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens interleukin 1 receptor antagonist (IL1RN), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    480
  • Annotation
    This variant (3) lacks an inframe coding segment, as compared to variant 2. The resulting isoform (3) lacks an internal region, as compared to the longest isoform (2).
  • siRNA

    AGGACCAAAUGUCAAUUUAtt

    GAAUCUGGGAUGUUAACCAtt

    AGAUAGAUGUGGUACCCAUtt

  • DataSheet:
  • DataSheet:
  • Vector Name
    pEXP-Entry
  • primers
    T7: TAATACGACTCACTATAGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4919
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    Myc,FLAG
  • Description
    ORFs cloned in this vector will be expressed in mammalian cellsas a tagged protein with the C-terminal Myc-FLAG tags.
    Such clones are the best for detection and purification of the transgene using anti-Myc or anti-FLAG antibodies.
  • Vector Name
    pEXP-untagged
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    6223
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Hygromycin
  • Protein Tag
    None
  • Description
    All of the pEXP vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
    • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
    • Hygromycin resistance gene for selection of mammalian cell lines.
    • A Kozak consensus sequence to enhance mammalian expression.
  • Vector Name
    pGEM-T
  • primers
    T7: TAATACGACTCACTATAGGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    3000
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    The pGEM-T is 3kb in length, and contains the amplicin resistance gene, conferring selection of the plasmid in E. coli, and the ori site which is the bacterial origin of replication. The plasmid has multiple cloning sites as shown below. The coding sequence was inserted by TA cloning. Many E. coli strains are suitable for the propagation of this vector including JM109, DH5α and TOP10.
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pUC18c
  • primers
    M13 fwd: GTAAAACGACGGCCAGT
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    2693
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    pMD18-T Vector is a high-efficiency TA cloning vector constructed from pUC18, of which the initial multiple cloning sites (MCS) were destroyed. Thus the cDNA should be amplified by PCR with primers containing a restriction site for subclone. Competent cells appropriate for pUC18 are also appropriated for this Vector, e.g. JM109, DH5α, TOP10. The pMD18-T Simple Vector is 2.6kb in size. Selection of the plasmid in E. coli is conferred by the ampicillin resistance gene. The coding sequence was inserted by TA cloning at site 425.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"