Cart 2
  • IFIT3 Human  cDNA/ORF Clone

IFIT3 Human cDNA/ORF Clone

Cat.#: 713796-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 225.7 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    interferon induced protein with tetratricopeptide repeats 3
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    IFIT3
  • Gene Type
    protein coding
  • Also Known as
    P60; IRG2; IFI60; IFIT4; ISG60; RIG-G; cig41; CIG-49; GARG-49
  • Encoded Protein Alias
    interferon-induced protein with tetratricopeptide repeats 3; CIG49; IFI-60K; IFIT-3; IFIT-4; ISG-60; interferon-induced 60 kDa protein; interferon-induced protein with tetratricopeptide repeats 4; retinoic acid-induced gene G protein
  • Product Name
    IFIT3(NM_001289759) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens interferon induced protein with tetratricopeptide repeats 3 (IFIT3), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    1317
  • Annotation
    This variant (3) contains an alternate exon compared to variant 1. The resulting isoform (b) uses a translation initiation site at a downstream AUG that results in an isoform (b) with a shorter N-terminus compared to isoform 1. Variants 3 and 4 both encode the same isoform (b).
  • siRNA

    GAGACGGAAUGUUAUCAGAtt

    GCUAUGGACUAUUCGAAUAtt

    GCUGAGUCCUGAUAACCAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    IFIT3(NM_001549) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens interferon induced protein with tetratricopeptide repeats 3 (IFIT3), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    1473
  • Annotation
    This variant (2) differs in the 5' UTR and 5' coding region compared to variant 1. Variants 1 and 2 both encode isoform a, using different start codons but encoding identical proteins.
  • siRNA

    GAGACGGAAUGUUAUCAGAtt

    GCUAUGGACUAUUCGAAUAtt

    GCUGAGUCCUGAUAACCAAtt

  • DataSheet:
  • FAQs:
  • DataSheet:
  • FAQs:
  • Vector Name
    pOTB7
  • primers
    M13 fwd: GTAAAACGACGGCCAGT
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    1815
  • Vector Type
    Cloning Vector
  • Promoter
    -
  • Antibiotic Resistance
    Chloramphenicol
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    Gateway® or compatible clone with M13 forward and M13 reverse primers. Chloramphenicol resistance in bacteria.
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"