NovoPro
Cart 2
  • IFNGR2 Human  cDNA/ORF Clones

IFNGR2 Human cDNA/ORF Clones

Cat.#: 713546-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 214.7 USD

Availability: In Stock
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    interferon gamma receptor 2 (interferon gamma transducer 1)
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    IFNGR2
  • Gene Type
    protein coding
  • Also Known as
    AF-1; IFGR2; IMD28; IFNGT1
  • Encoded Protein Alias
    interferon gamma receptor 2; IFN-gamma receptor 2; IFN-gamma-R2; interferon gamma receptor accessory factor 1; interferon gamma receptor accessory factor-1; interferon gamma receptor beta chain; interferon gamma transducer 1
  • Product Name
    IFNGR2(NM_005534) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens interferon gamma receptor 2 (interferon gamma transducer 1) (IFNGR2), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    1014
  • siRNA

    GGAACAUUUUCGUUGCUGUtt

    CAACAUAUCUUGCUACGAAtt

    CAUUAUCUCGUUUCCGGAAtt

  • DataSheet:
  • DataSheet:
  • Product Name
    IFNGR2(XM_011529553) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens interferon gamma receptor 2 (interferon gamma transducer 1) (IFNGR2), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    1089
  • siRNA

    GGAACAUUUUCGUUGCUGUtt

    CAACAUAUCUUGCUACGAAtt

    CAUUAUCUCGUUUCCGGAAtt

  • DataSheet:
  • Product Name
    IFNGR2(XM_011529554) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens interferon gamma receptor 2 (interferon gamma transducer 1) (IFNGR2), transcript variant X3, mRNA.
  • Synonyms
  • ORF length
    1020
  • siRNA

    GGAACAUUUUCGUUGCUGUtt

    CAACAUAUCUUGCUACGAAtt

    CAUUAUCUCGUUUCCGGAAtt

  • DataSheet:
  • Product Name
    IFNGR2(NM_001329128) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens interferon gamma receptor 2 (interferon gamma transducer 1) (IFNGR2), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    1071
  • Annotation
    This variant (1) represents the longer transcript and encodes the longer isoform (1).
  • siRNA
  • DataSheet:
  • Vector Name
    pOTB7
  • primers
    M13 fwd: GTAAAACGACGGCCAGT
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    1815
  • Vector Type
    Cloning Vector
  • Promoter
    -
  • Antibiotic Resistance
    Chloramphenicol
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    Gateway® or compatible clone with M13 forward and M13 reverse primers. Chloramphenicol resistance in bacteria.
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"