NovoPro
Cart 2
  • IGF2 Dog  cDNA/ORF Clones

IGF2 Dog cDNA/ORF Clones

Cat.#: 700527-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 122.6 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    insulin like growth factor 2
  • Organism
    Dog
  • Entrez Gene ID
  • Gene Symbol
    IGF2
  • Gene Type
    protein coding
  • Encoded Protein Alias
    insulin-like growth factor II
  • Product Name
    IGF2(XM_005631053) Dog cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Canis lupus familiaris insulin-like growth factor 2 (IGF2), transcript variant X4, mRNA.
  • Synonyms
  • ORF length
    717
  • DataSheet:
  • Product Name
    IGF2(NM_001195827) Dog cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Canis lupus familiaris insulin-like growth factor 2 (somatomedin A) (IGF2), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    555
  • Annotation
    This variant (2) uses an alternate in-frame splice site in the coding region, compared to variant 1. It encodes isoform b, which is shorter than isoform a.
  • DataSheet:
  • Product Name
    IGF2(NM_001195825) Dog cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Canis lupus familiaris insulin-like growth factor 2 (somatomedin A) (IGF2), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    564
  • Annotation
    This variant (1) represents the longest transcript and encodes the longer isoform (a), which is also encoded by variant 3.
  • DataSheet:
  • Vector Name
    pGEM-T
  • primers
    T7: TAATACGACTCACTATAGGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    3000
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    The pGEM-T is 3kb in length, and contains the amplicin resistance gene, conferring selection of the plasmid in E. coli, and the ori site which is the bacterial origin of replication. The plasmid has multiple cloning sites as shown below. The coding sequence was inserted by TA cloning. Many E. coli strains are suitable for the propagation of this vector including JM109, DH5α and TOP10.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"