NovoPro
Cart 2
  • INO80E Human  cDNA/ORF Clones

INO80E Human cDNA/ORF Clones

Cat.#: 701589-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 122.6 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    INO80 complex subunit E
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    INO80E
  • Gene Type
    protein coding
  • Also Known as
    CCDC95
  • Encoded Protein Alias
    INO80 complex subunit E; coiled-coil domain containing 95; coiled-coil domain-containing protein 95
  • Product Name
    INO80E(XM_011545809) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens INO80 complex subunit E (INO80E), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    588
  • siRNA

    GCCACUGCAUCAUCAGAUAtt

    ACGAGAACGUGGAUGAAGAtt

    GAAAGCGCAAAGGAAAUUAtt

    GCGCAAAGGAAAUUACUGAtt

  • DataSheet:
  • Product Name
    INO80E(NM_001304562) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens INO80 complex subunit E (INO80E), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    618
  • Annotation
    This variant (2) lacks an alternate in-frame exon compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is shorter compared to isoform 1.
  • siRNA

    GCCACUGCAUCAUCAGAUAtt

    ACGAGAACGUGGAUGAAGAtt

    GAAAGCGCAAAGGAAAUUAtt

    GCGCAAAGGAAAUUACUGAtt

  • DataSheet:
  • Product Name
    INO80E(XM_017023169) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens INO80 complex subunit E (INO80E), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    603
  • siRNA

    GCCACUGCAUCAUCAGAUAtt

    ACGAGAACGUGGAUGAAGAtt

    GAAAGCGCAAAGGAAAUUAtt

    GCGCAAAGGAAAUUACUGAtt

  • DataSheet:
  • Product Name
    INO80E(XM_011545811) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens INO80 complex subunit E (INO80E), transcript variant X3, mRNA.
  • Synonyms
  • ORF length
    579
  • siRNA

    GCCACUGCAUCAUCAGAUAtt

    ACGAGAACGUGGAUGAAGAtt

    GAAAGCGCAAAGGAAAUUAtt

    GCGCAAAGGAAAUUACUGAtt

  • DataSheet:
  • Product Name
    INO80E(XM_011545812) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens INO80 complex subunit E (INO80E), transcript variant X4, mRNA.
  • Synonyms
  • ORF length
    531
  • siRNA

    GCCACUGCAUCAUCAGAUAtt

    ACGAGAACGUGGAUGAAGAtt

    GAAAGCGCAAAGGAAAUUAtt

    GCGCAAAGGAAAUUACUGAtt

  • DataSheet:
  • Product Name
    INO80E(NM_173618) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens INO80 complex subunit E (INO80E), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    735
  • Annotation
    This variant (1) encodes the longest isoform (1).
  • siRNA

    GCCACUGCAUCAUCAGAUAtt

    ACGAGAACGUGGAUGAAGAtt

    GAAAGCGCAAAGGAAAUUAtt

    GCGCAAAGGAAAUUACUGAtt

  • DataSheet:
  • DataSheet:
  • DataSheet:
  • DataSheet:
  • Product Name
    INO80E(NM_001304563) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens INO80 complex subunit E (INO80E), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    582
  • Annotation
    This variant (3) contains an alternate exon in the 3' end compared to variant 1. The resulting isoform (3) has a shorter and distinct C-terminus compared to isoform 1.
  • siRNA

    GCCACUGCAUCAUCAGAUAtt

    ACGAGAACGUGGAUGAAGAtt

    GAAAGCGCAAAGGAAAUUAtt

    GCGCAAAGGAAAUUACUGAtt

  • DataSheet:
  • Vector Name
    pCMV-SPORT6
  • primers
    T7: TAATACGACTCACTATAGGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4396
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    Vector for cloning and transient mammalian cell expression of cDNAs.
  • Vector Name
    pEXP-Entry
  • primers
    T7: TAATACGACTCACTATAGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4919
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    Myc,FLAG
  • Description
    ORFs cloned in this vector will be expressed in mammalian cellsas a tagged protein with the C-terminal Myc-FLAG tags.
    Such clones are the best for detection and purification of the transgene using anti-Myc or anti-FLAG antibodies.
  • Vector Name
    pGEM-T
  • primers
    T7: TAATACGACTCACTATAGGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    3000
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    The pGEM-T is 3kb in length, and contains the amplicin resistance gene, conferring selection of the plasmid in E. coli, and the ori site which is the bacterial origin of replication. The plasmid has multiple cloning sites as shown below. The coding sequence was inserted by TA cloning. Many E. coli strains are suitable for the propagation of this vector including JM109, DH5α and TOP10.
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"