NovoPro
Cart 2
  • IL5 Equus caballus  cDNA/ORF Clones

IL5 Equus caballus cDNA/ORF Clones

Cat.#: 721281-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 122.6 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    interleukin 5
  • Organism
    Equus caballus
  • Entrez Gene ID
  • Gene Symbol
    IL5
  • Gene Type
    protein coding
  • Also Known as
    IL-5
  • Encoded Protein Alias
    T-cell replacing factor; TRF; eosinophil differentiation factor; interleukin 5 (colony-stimulating factor, eosinophil)
  • Product Name
    IL5(NM_001082499) Equus caballus cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Equus caballus interleukin 5 (IL5), mRNA.
  • Synonyms
  • ORF length
    405
  • DataSheet:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"