NovoPro
Cart 2
  • IL18 Felis catus  cDNA/ORF Clones

IL18 Felis catus cDNA/ORF Clones

Cat.#: 733773-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 122.6 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    interleukin 18
  • Organism
    Felis catus
  • Entrez Gene ID
  • Gene Symbol
    IL18
  • Gene Type
    protein coding
  • Also Known as
    IGIF
  • Encoded Protein Alias
    IFN-gamma-inducing factor; IL-1 gamma; IL-18; interferon gamma inducing factor; interferon gamma-inducing factor; interferon-gamma-inducing factor; interleukin 18 (interferon-gamma-inducing factor); interleukin-1 gamma
  • Product Name
    IL18(XM_006936584) Felis catus cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Felis catus interleukin 18 (IL18), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    579
  • DataSheet:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"