NovoPro
Cart 2
  • IL13 Chimpanzee  cDNA/ORF Clones

IL13 Chimpanzee cDNA/ORF Clones

Cat.#: 732634-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 122.6 USD

Availability: 5-8 days
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    interleukin 13
  • Organism
    Chimpanzee
  • Entrez Gene ID
  • Gene Symbol
    IL13
  • Gene Type
    protein coding
  • Encoded Protein Alias
    IL-13
  • Product Name
    IL13(XM_009449488) Chimpanzee cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Pan troglodytes interleukin 13 (IL13), transcript variant X3, mRNA.
  • Synonyms
  • ORF length
    246
  • DataSheet:
  • Product Name
    IL13(XM_009449487) Chimpanzee cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Pan troglodytes interleukin 13 (IL13), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    366
  • DataSheet:
  • Product Name
    IL13(NM_001008992) Chimpanzee cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Pan troglodytes interleukin 13 (IL13), mRNA.
  • Synonyms
  • ORF length
    399
  • DataSheet:
  • Product Name
    IL13(XM_016944946) Chimpanzee cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Pan troglodytes interleukin 13 (IL13), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    396
  • DataSheet:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"