Cart 2
  • Igf2 Rat  cDNA/ORF Clone

Igf2 Rat cDNA/ORF Clone

Cat.#: 747193-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 122.6 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    insulin-like growth factor 2
  • Organism
    Rat
  • Entrez Gene ID
  • Gene Symbol
    Igf2
  • Gene Type
    protein coding
  • Also Known as
    IGFII; RNIGF2
  • Encoded Protein Alias
    IGF-II; Insulin-like growth factor II (somatomedin A); MSA; insulin-like growth factor II (IGF-II); insulin-like growth factor II isoform 2 variant 4 preprotein; multiplication-stimulating activity; multiplication-stimulating polypeptide
  • Product Name
    Igf2(NM_031511) Rat cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Rattus norvegicus insulin-like growth factor 2 (Igf2), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    576
  • Annotation
    This variant (1) represents the longest transcript and encodes the longer isoform (1).
  • siRNA

    AACUGAAAAUAGAACCUAAtt

    UGAUCGUGUUACCACCCAAtt

    CAUGAAAACUGAAAAUAGAtt

    GGCUCAGACUUGGAUCUCAtt

    GGCUCAGACUUGGAUCUCAtt

  • DataSheet:
  • FAQs:
  • Product Name
    Igf2(NM_001190162) Rat cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Rattus norvegicus insulin-like growth factor 2 (Igf2), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    543
  • Annotation
    This variant (2) uses an alternate exon at its 5' terminus and uses a downstream in-frame start codon, compared to variant 1. This results in a protein (isoform 2) with a shorter N-terminus, compared to isoform 1. Variants 2 and 3 encode the same protein.
  • siRNA

    AACUGAAAAUAGAACCUAAtt

    UGAUCGUGUUACCACCCAAtt

    CAUGAAAACUGAAAAUAGAtt

    GGCUCAGACUUGGAUCUCAtt

    GGCUCAGACUUGGAUCUCAtt

  • DataSheet:
  • FAQs:
  • Product Name
    Igf2(XM_006230664) Rat cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Rattus norvegicus insulin-like growth factor 2 (Igf2), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    1035
  • siRNA

    AACUGAAAAUAGAACCUAAtt

    UGAUCGUGUUACCACCCAAtt

    CAUGAAAACUGAAAAUAGAtt

    GGCUCAGACUUGGAUCUCAtt

    GGCUCAGACUUGGAUCUCAtt

  • DataSheet:
  • FAQs:
  • Product Name
    Igf2(XM_008760074) Rat cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Rattus norvegicus insulin-like growth factor 2 (Igf2), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    981
  • siRNA

    AACUGAAAAUAGAACCUAAtt

    UGAUCGUGUUACCACCCAAtt

    CAUGAAAACUGAAAAUAGAtt

    GGCUCAGACUUGGAUCUCAtt

    GGCUCAGACUUGGAUCUCAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"