NovoPro
Cart 2
  • TTN Human  cDNA/ORF Clone

TTN Human cDNA/ORF Clone

Cat.#: 767923-1

  • Accession#:
  • Vector:
Optional Service:

Special Price Inquiry USD

Availability: Inquiry
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    titin
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    TTN
  • Gene Type
    protein coding
  • Also Known as
    TMD; CMH9; CMD1G; CMPD4; EOMFC; HMERF; MYLK5; LGMD2J
  • Product Name
    TTN(NM_133437) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens titin (TTN), transcript variant novex-2, mRNA.
  • Synonyms
  • ORF length
    81357
  • Annotation
    This variant (novex-2) encodes the minor cardiac and skeletal muscle isoform (novex-2 or novex-2/N2B), which is nearly identical to the major cardiac isoform N2-B but contains a unique stretch of 192 aa in the I-band region. This variant is supported by data in PMID:11717165.
  • siRNA

    GGAAGACUACCAAAUCGAAtt

    GAAUCAAGACAAACCCGAAtt

    CUAUUGUUGUUCGCAAUAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    TTN(NM_003319) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens titin (TTN), transcript variant N2-B, mRNA.
  • Synonyms
  • ORF length
    80781
  • Annotation
    This variant (N2-B) encodes the major cardiac muscle isoform (N2-B). It lacks multiple exons in the region encoding PEVK repeats. This results in a shortened PEVK region in isoform N2-B compared to isoform IC. This variant is supported by data in PMIDs 10850961 and 11717165.
  • siRNA

    GGAAGACUACCAAAUCGAAtt

    GAAUCAAGACAAACCCGAAtt

    CUAUUGUUGUUCGCAAUAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    TTN(NM_133379) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens titin (TTN), transcript variant novex-3, mRNA.
  • Synonyms
  • ORF length
    16815
  • Annotation
    This variant (novex-3) is the shortest transcript and encodes the shortest isoform (novex-3). Its last exon is nearly 8 kb and is not found in the other variants. The novex-3 isoform, which is found in all striated muscle, lacks the PEVK region and has a C-terminal truncation compared to longer isoforms. This variant is supported by data in PMID:11717165.
  • siRNA

    GGAAGACUACCAAAUCGAAtt

    GAAUCAAGACAAACCCGAAtt

    CUAUUGUUGUUCGCAAUAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    TTN(NM_133378) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens titin (TTN), transcript variant N2-A, mRNA.
  • Synonyms
  • ORF length
    100272
  • Annotation
    This variant (N2-A) encodes isoform N2-A, which is the predominant titin isoform in skeletal muscle. This variant lacks the N2B region but includes the PEVK region. This variant is supported by data in PMIDs 7569978, 10850961 and 11717165.
  • siRNA

    GGAAGACUACCAAAUCGAAtt

    GAAUCAAGACAAACCCGAAtt

    CUAUUGUUGUUCGCAAUAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    TTN(NM_001256850) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens titin (TTN), transcript variant N2BA, mRNA.
  • Synonyms
  • ORF length
    103053
  • Annotation
    This variant (N2BA) encodes another major cardiac isoform (N2BA). It includes the N2A and N2B exons, and also the PEVK region. This variant is supported by annotation on DNA accession AJ277892.2 and by accompanying data in PMIDs 10850961 and 11717165.
  • siRNA

    GGAAGACUACCAAAUCGAAtt

    GAAUCAAGACAAACCCGAAtt

    CUAUUGUUGUUCGCAAUAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    TTN(NM_133432) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens titin (TTN), transcript variant novex-1, mRNA.
  • Synonyms
  • ORF length
    81156
  • Annotation
    This variant (novex-1) encodes the minor cardiac muscle isoform (novex-1 or novex-1/N2B), which is nearly identical to the major cardiac isoform N2-B but contains a unique stretch of 125 aa in the I-band region. This variant is supported by data in PMID:11717165.
  • siRNA

    GGAAGACUACCAAAUCGAAtt

    GAAUCAAGACAAACCCGAAtt

    CUAUUGUUGUUCGCAAUAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    TTN(NM_001267550) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens titin (TTN), transcript variant IC, mRNA.
  • Synonyms
  • ORF length
    107976
  • Annotation
    This variant (IC) represents an inferred complete model that includes all possible supported in-frame coding exons. The exons included in this inferred variant are supported by the original sequence analysis, publication data(PMID:11717165), available cDNA and EST data, and additional sequence analysis of the repetitive exons. This transcript is the longest and represents a 363-exon model encoding a predicted protein (isoform IC) of 35,991 amino acids.
  • siRNA

    GGAAGACUACCAAAUCGAAtt

    GAAUCAAGACAAACCCGAAtt

    CUAUUGUUGUUCGCAAUAAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"