NovoPro
Cart 2
  • TRRAP Human  cDNA/ORF Clone

TRRAP Human cDNA/ORF Clone

Cat.#: 767920-1

  • Accession#:
  • Vector:
Optional Service:

Special Price Inquiry USD

Availability: Inquiry
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    transformation/transcription domain associated protein
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    TRRAP
  • Gene Type
    protein coding
  • Also Known as
    Tra1; TR-AP; PAF400; STAF40; PAF350/400
  • Product Name
    TRRAP(NM_003496) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens transformation/transcription domain associated protein (TRRAP), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    11493
  • Annotation
    This variant (2) lacks an exon and uses an alternate splice site in the coding region, but maintains the reading frame, compared to variant 1. The encoded isoform (2) is shorter than isoform 1.
  • siRNA

    CUACGAUUCUGGUGGAAUAtt

    GGAAUUACGGAGAUAUAGAtt

    GAAUUACGGAGAUAUAGAAtt

    GAACAGGCGUGGUAUGCAAtt

    GAUGAUGACUUACAUAGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    TRRAP(NM_001244580) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens transformation/transcription domain associated protein (TRRAP), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    11580
  • Annotation
    This variant (1) represents the longer transcript and encodes the longer isoform (1).
  • siRNA

    CUACGAUUCUGGUGGAAUAtt

    GGAAUUACGGAGAUAUAGAtt

    GAAUUACGGAGAUAUAGAAtt

    GAACAGGCGUGGUAUGCAAtt

    GAUGAUGACUUACAUAGAAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"