NovoPro
Cart 2
  • TRIP12 Human  cDNA/ORF Clone

TRIP12 Human cDNA/ORF Clone

Cat.#: 767919-1

  • Accession#:
  • Vector:
Optional Service:

Special Price Inquiry USD

Availability: Inquiry
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    thyroid hormone receptor interactor 12
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    TRIP12
  • Gene Type
    protein coding
  • Also Known as
    ULF; TRIP-12
  • Product Name
    TRIP12(XM_005246957) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens thyroid hormone receptor interactor 12 (TRIP12), transcript variant X13, mRNA.
  • Synonyms
  • ORF length
    6192
  • siRNA

    GCGAGUAAGUUGUAAGUUUtt

    GGCCGGUAUUUAUUAUUCUtt

    GAACUUUCACUAGCAGGAUtt

    GAUUUUGACUCAAACUCUAtt

    AGUCAUAGCUAACACCGAAtt

    UCCUAUCAACGAGCACUAAtt

    ACACUUAGUUGGGUAACAAtt

    AGUCGUUACCUGUUUAAAAtt

    AGACUGAAACAAUUUGUUUtt

    AAAGGGUUCUGUUAAAAUUtt

    GCACCUAGAUUGGAUAGAAtt

    GAUUGAUCUUGUUCCACGAtt

    GCAAUUUGAUUCGUUCAGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    TRIP12(XM_017005293) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens thyroid hormone receptor interactor 12 (TRIP12), transcript variant X34, mRNA.
  • Synonyms
  • ORF length
    5997
  • siRNA

    GCGAGUAAGUUGUAAGUUUtt

    GGCCGGUAUUUAUUAUUCUtt

    GAACUUUCACUAGCAGGAUtt

    GAUUUUGACUCAAACUCUAtt

    AGUCAUAGCUAACACCGAAtt

    UCCUAUCAACGAGCACUAAtt

    ACACUUAGUUGGGUAACAAtt

    AGUCGUUACCUGUUUAAAAtt

    AGACUGAAACAAUUUGUUUtt

    AAAGGGUUCUGUUAAAAUUtt

    GCACCUAGAUUGGAUAGAAtt

    GAUUGAUCUUGUUCCACGAtt

    GCAAUUUGAUUCGUUCAGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    TRIP12(XM_017005291) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens thyroid hormone receptor interactor 12 (TRIP12), transcript variant X32, mRNA.
  • Synonyms
  • ORF length
    5994
  • siRNA

    GCGAGUAAGUUGUAAGUUUtt

    GGCCGGUAUUUAUUAUUCUtt

    GAACUUUCACUAGCAGGAUtt

    GAUUUUGACUCAAACUCUAtt

    AGUCAUAGCUAACACCGAAtt

    UCCUAUCAACGAGCACUAAtt

    ACACUUAGUUGGGUAACAAtt

    AGUCGUUACCUGUUUAAAAtt

    AGACUGAAACAAUUUGUUUtt

    AAAGGGUUCUGUUAAAAUUtt

    GCACCUAGAUUGGAUAGAAtt

    GAUUGAUCUUGUUCCACGAtt

    GCAAUUUGAUUCGUUCAGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    TRIP12(XM_017005290) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens thyroid hormone receptor interactor 12 (TRIP12), transcript variant X31, mRNA.
  • Synonyms
  • ORF length
    6036
  • siRNA

    GCGAGUAAGUUGUAAGUUUtt

    GGCCGGUAUUUAUUAUUCUtt

    GAACUUUCACUAGCAGGAUtt

    GAUUUUGACUCAAACUCUAtt

    AGUCAUAGCUAACACCGAAtt

    UCCUAUCAACGAGCACUAAtt

    ACACUUAGUUGGGUAACAAtt

    AGUCGUUACCUGUUUAAAAtt

    AGACUGAAACAAUUUGUUUtt

    AAAGGGUUCUGUUAAAAUUtt

    GCACCUAGAUUGGAUAGAAtt

    GAUUGAUCUUGUUCCACGAtt

    GCAAUUUGAUUCGUUCAGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    TRIP12(XM_017005288) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens thyroid hormone receptor interactor 12 (TRIP12), transcript variant X28, mRNA.
  • Synonyms
  • ORF length
    6063
  • siRNA

    GCGAGUAAGUUGUAAGUUUtt

    GGCCGGUAUUUAUUAUUCUtt

    GAACUUUCACUAGCAGGAUtt

    GAUUUUGACUCAAACUCUAtt

    AGUCAUAGCUAACACCGAAtt

    UCCUAUCAACGAGCACUAAtt

    ACACUUAGUUGGGUAACAAtt

    AGUCGUUACCUGUUUAAAAtt

    AGACUGAAACAAUUUGUUUtt

    AAAGGGUUCUGUUAAAAUUtt

    GCACCUAGAUUGGAUAGAAtt

    GAUUGAUCUUGUUCCACGAtt

    GCAAUUUGAUUCGUUCAGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    TRIP12(NM_001284215) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens thyroid hormone receptor interactor 12 (TRIP12), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    6078
  • Annotation
    This variant (2) has a shorter 5' UTR, lacks an alternate in-frame exon in the 5' coding region, and uses an alternate in-frame splice site in the central coding region, compared to variant 1. The encoded isoform (b) is shorter than isoform a.
  • siRNA

    GCGAGUAAGUUGUAAGUUUtt

    GGCCGGUAUUUAUUAUUCUtt

    GAACUUUCACUAGCAGGAUtt

    GAUUUUGACUCAAACUCUAtt

    AGUCAUAGCUAACACCGAAtt

    UCCUAUCAACGAGCACUAAtt

    ACACUUAGUUGGGUAACAAtt

    AGUCGUUACCUGUUUAAAAtt

    AGACUGAAACAAUUUGUUUtt

    AAAGGGUUCUGUUAAAAUUtt

    GCACCUAGAUUGGAUAGAAtt

    GAUUGAUCUUGUUCCACGAtt

    GCAAUUUGAUUCGUUCAGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    TRIP12(NM_001284214) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens thyroid hormone receptor interactor 12 (TRIP12), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    6123
  • Annotation
    This variant (1) represents the longest transcript and encodes the longest isoform (a).
  • siRNA

    GCGAGUAAGUUGUAAGUUUtt

    GGCCGGUAUUUAUUAUUCUtt

    GAACUUUCACUAGCAGGAUtt

    GAUUUUGACUCAAACUCUAtt

    AGUCAUAGCUAACACCGAAtt

    UCCUAUCAACGAGCACUAAtt

    ACACUUAGUUGGGUAACAAtt

    AGUCGUUACCUGUUUAAAAtt

    AGACUGAAACAAUUUGUUUtt

    AAAGGGUUCUGUUAAAAUUtt

    GCACCUAGAUUGGAUAGAAtt

    GAUUGAUCUUGUUCCACGAtt

    GCAAUUUGAUUCGUUCAGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    TRIP12(XM_017005279) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens thyroid hormone receptor interactor 12 (TRIP12), transcript variant X14, mRNA.
  • Synonyms
  • ORF length
    6189
  • siRNA

    GCGAGUAAGUUGUAAGUUUtt

    GGCCGGUAUUUAUUAUUCUtt

    GAACUUUCACUAGCAGGAUtt

    GAUUUUGACUCAAACUCUAtt

    AGUCAUAGCUAACACCGAAtt

    UCCUAUCAACGAGCACUAAtt

    ACACUUAGUUGGGUAACAAtt

    AGUCGUUACCUGUUUAAAAtt

    AGACUGAAACAAUUUGUUUtt

    AAAGGGUUCUGUUAAAAUUtt

    GCACCUAGAUUGGAUAGAAtt

    GAUUGAUCUUGUUCCACGAtt

    GCAAUUUGAUUCGUUCAGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    TRIP12(XM_017005289) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens thyroid hormone receptor interactor 12 (TRIP12), transcript variant X30, mRNA.
  • Synonyms
  • ORF length
    6039
  • siRNA

    GCGAGUAAGUUGUAAGUUUtt

    GGCCGGUAUUUAUUAUUCUtt

    GAACUUUCACUAGCAGGAUtt

    GAUUUUGACUCAAACUCUAtt

    AGUCAUAGCUAACACCGAAtt

    UCCUAUCAACGAGCACUAAtt

    ACACUUAGUUGGGUAACAAtt

    AGUCGUUACCUGUUUAAAAtt

    AGACUGAAACAAUUUGUUUtt

    AAAGGGUUCUGUUAAAAUUtt

    GCACCUAGAUUGGAUAGAAtt

    GAUUGAUCUUGUUCCACGAtt

    GCAAUUUGAUUCGUUCAGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    TRIP12(NM_004238) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens thyroid hormone receptor interactor 12 (TRIP12), transcript variant 3, mRNA.
  • Synonyms
    XM_376178  
  • ORF length
    5979
  • Annotation
    This variant (3) lacks an alternate in-frame exon and uses an alternate in-frame splice site in the 5' coding region, compared to variant 1. The encoded isoform (c) is shorter than isoform a.
  • siRNA

    GCGAGUAAGUUGUAAGUUUtt

    GGCCGGUAUUUAUUAUUCUtt

    GAACUUUCACUAGCAGGAUtt

    GAUUUUGACUCAAACUCUAtt

    AGUCAUAGCUAACACCGAAtt

    UCCUAUCAACGAGCACUAAtt

    ACACUUAGUUGGGUAACAAtt

    AGUCGUUACCUGUUUAAAAtt

    AGACUGAAACAAUUUGUUUtt

    AAAGGGUUCUGUUAAAAUUtt

    GCACCUAGAUUGGAUAGAAtt

    GAUUGAUCUUGUUCCACGAtt

    GCAAUUUGAUUCGUUCAGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    TRIP12(XM_005246960) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens thyroid hormone receptor interactor 12 (TRIP12), transcript variant X18, mRNA.
  • Synonyms
  • ORF length
    6120
  • siRNA

    GCGAGUAAGUUGUAAGUUUtt

    GGCCGGUAUUUAUUAUUCUtt

    GAACUUUCACUAGCAGGAUtt

    GAUUUUGACUCAAACUCUAtt

    AGUCAUAGCUAACACCGAAtt

    UCCUAUCAACGAGCACUAAtt

    ACACUUAGUUGGGUAACAAtt

    AGUCGUUACCUGUUUAAAAtt

    AGACUGAAACAAUUUGUUUtt

    AAAGGGUUCUGUUAAAAUUtt

    GCACCUAGAUUGGAUAGAAtt

    GAUUGAUCUUGUUCCACGAtt

    GCAAUUUGAUUCGUUCAGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    TRIP12(XM_017005283) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens thyroid hormone receptor interactor 12 (TRIP12), transcript variant X20, mRNA.
  • Synonyms
  • ORF length
    6108
  • siRNA

    GCGAGUAAGUUGUAAGUUUtt

    GGCCGGUAUUUAUUAUUCUtt

    GAACUUUCACUAGCAGGAUtt

    GAUUUUGACUCAAACUCUAtt

    AGUCAUAGCUAACACCGAAtt

    UCCUAUCAACGAGCACUAAtt

    ACACUUAGUUGGGUAACAAtt

    AGUCGUUACCUGUUUAAAAtt

    AGACUGAAACAAUUUGUUUtt

    AAAGGGUUCUGUUAAAAUUtt

    GCACCUAGAUUGGAUAGAAtt

    GAUUGAUCUUGUUCCACGAtt

    GCAAUUUGAUUCGUUCAGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    TRIP12(NM_001284216) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens thyroid hormone receptor interactor 12 (TRIP12), transcript variant 4, mRNA.
  • Synonyms
  • ORF length
    5169
  • Annotation
    This variant (4) lacks three alternate exons that result in the loss of an in-frame segment in the 5' coding region, and uses an alternate in-frame splice site in the central coding region, compared to variant 1. The encoded isoform (d) is shorter than isoform a.
  • siRNA

    GCGAGUAAGUUGUAAGUUUtt

    GGCCGGUAUUUAUUAUUCUtt

    GAACUUUCACUAGCAGGAUtt

    GAUUUUGACUCAAACUCUAtt

    AGUCAUAGCUAACACCGAAtt

    UCCUAUCAACGAGCACUAAtt

    ACACUUAGUUGGGUAACAAtt

    AGUCGUUACCUGUUUAAAAtt

    AGACUGAAACAAUUUGUUUtt

    AAAGGGUUCUGUUAAAAUUtt

    GCACCUAGAUUGGAUAGAAtt

    GAUUGAUCUUGUUCCACGAtt

    GCAAUUUGAUUCGUUCAGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    TRIP12(XM_017005292) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens thyroid hormone receptor interactor 12 (TRIP12), transcript variant X33, mRNA.
  • Synonyms
  • ORF length
    5982
  • siRNA

    GCGAGUAAGUUGUAAGUUUtt

    GGCCGGUAUUUAUUAUUCUtt

    GAACUUUCACUAGCAGGAUtt

    GAUUUUGACUCAAACUCUAtt

    AGUCAUAGCUAACACCGAAtt

    UCCUAUCAACGAGCACUAAtt

    ACACUUAGUUGGGUAACAAtt

    AGUCGUUACCUGUUUAAAAtt

    AGACUGAAACAAUUUGUUUtt

    AAAGGGUUCUGUUAAAAUUtt

    GCACCUAGAUUGGAUAGAAtt

    GAUUGAUCUUGUUCCACGAtt

    GCAAUUUGAUUCGUUCAGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    TRIP12(XM_017005277) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens thyroid hormone receptor interactor 12 (TRIP12), transcript variant X8, mRNA.
  • Synonyms
  • ORF length
    6204
  • siRNA

    GCGAGUAAGUUGUAAGUUUtt

    GGCCGGUAUUUAUUAUUCUtt

    GAACUUUCACUAGCAGGAUtt

    GAUUUUGACUCAAACUCUAtt

    AGUCAUAGCUAACACCGAAtt

    UCCUAUCAACGAGCACUAAtt

    ACACUUAGUUGGGUAACAAtt

    AGUCGUUACCUGUUUAAAAtt

    AGACUGAAACAAUUUGUUUtt

    AAAGGGUUCUGUUAAAAUUtt

    GCACCUAGAUUGGAUAGAAtt

    GAUUGAUCUUGUUCCACGAtt

    GCAAUUUGAUUCGUUCAGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    TRIP12(XM_005246958) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens thyroid hormone receptor interactor 12 (TRIP12), transcript variant X16, mRNA.
  • Synonyms
  • ORF length
    6126
  • siRNA

    GCGAGUAAGUUGUAAGUUUtt

    GGCCGGUAUUUAUUAUUCUtt

    GAACUUUCACUAGCAGGAUtt

    GAUUUUGACUCAAACUCUAtt

    AGUCAUAGCUAACACCGAAtt

    UCCUAUCAACGAGCACUAAtt

    ACACUUAGUUGGGUAACAAtt

    AGUCGUUACCUGUUUAAAAtt

    AGACUGAAACAAUUUGUUUtt

    AAAGGGUUCUGUUAAAAUUtt

    GCACCUAGAUUGGAUAGAAtt

    GAUUGAUCUUGUUCCACGAtt

    GCAAUUUGAUUCGUUCAGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    TRIP12(XM_006712852) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens thyroid hormone receptor interactor 12 (TRIP12), transcript variant X22, mRNA.
  • Synonyms
  • ORF length
    6081
  • siRNA

    GCGAGUAAGUUGUAAGUUUtt

    GGCCGGUAUUUAUUAUUCUtt

    GAACUUUCACUAGCAGGAUtt

    GAUUUUGACUCAAACUCUAtt

    AGUCAUAGCUAACACCGAAtt

    UCCUAUCAACGAGCACUAAtt

    ACACUUAGUUGGGUAACAAtt

    AGUCGUUACCUGUUUAAAAtt

    AGACUGAAACAAUUUGUUUtt

    AAAGGGUUCUGUUAAAAUUtt

    GCACCUAGAUUGGAUAGAAtt

    GAUUGAUCUUGUUCCACGAtt

    GCAAUUUGAUUCGUUCAGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    TRIP12(XM_017005284) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens thyroid hormone receptor interactor 12 (TRIP12), transcript variant X21, mRNA.
  • Synonyms
  • ORF length
    6102
  • siRNA

    GCGAGUAAGUUGUAAGUUUtt

    GGCCGGUAUUUAUUAUUCUtt

    GAACUUUCACUAGCAGGAUtt

    GAUUUUGACUCAAACUCUAtt

    AGUCAUAGCUAACACCGAAtt

    UCCUAUCAACGAGCACUAAtt

    ACACUUAGUUGGGUAACAAtt

    AGUCGUUACCUGUUUAAAAtt

    AGACUGAAACAAUUUGUUUtt

    AAAGGGUUCUGUUAAAAUUtt

    GCACCUAGAUUGGAUAGAAtt

    GAUUGAUCUUGUUCCACGAtt

    GCAAUUUGAUUCGUUCAGAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"