NovoPro
Cart 2
  • TMBIM4 Human  cDNA/ORF Clone

TMBIM4 Human cDNA/ORF Clone

Cat.#: 767911-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 264.6 USD

Availability: 1 week
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    transmembrane BAX inhibitor motif containing 4
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    TMBIM4
  • Gene Type
    protein coding
  • Also Known as
    S1R; GAAP; LFG4; ZPRO; CGI-119
  • Product Name
    TMBIM4(NM_016056) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens transmembrane BAX inhibitor motif containing 4 (TMBIM4), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    717
  • Annotation
    This variant (2) lacks an alternate in-frame exon in the 5' coding region, compared to vairant 1, resulting in an isoform (b) that is shorter than isoform a.
  • siRNA

    GCUUUCAUACUGACUACUAtt

    CGAGGACGACUUCAACUAUtt

    GAUUUUUGCGUUGAUUUUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    TMBIM4(NM_001282610) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens transmembrane BAX inhibitor motif containing 4 (TMBIM4), transcript variant 4, mRNA.
  • Synonyms
  • ORF length
    624
  • Annotation
    This variant (4) uses an alternate splice site in the 5' coding region which results in the use of an alternate translational start codon, compared to variant 1. The encoded isoform (d) has a distinct N-terminus and is shorter than isoform a.
  • siRNA

    GCUUUCAUACUGACUACUAtt

    CGAGGACGACUUCAACUAUtt

    GAUUUUUGCGUUGAUUUUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    TMBIM4(NM_001282609) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens transmembrane BAX inhibitor motif containing 4 (TMBIM4), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    489
  • Annotation
    This variant (3) uses an alternate splice site that results in a frameshift in the 3' coding region, compared to variant 1. The encoded isoform (c) has a distinct C-terminus and is shorter than isoform a.
  • siRNA

    GCUUUCAUACUGACUACUAtt

    CGAGGACGACUUCAACUAUtt

    GAUUUUUGCGUUGAUUUUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    TMBIM4(NM_001282606) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens transmembrane BAX inhibitor motif containing 4 (TMBIM4), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    858
  • Annotation
    This variant (1) represents the longest transcript and enocdes the longest isoform (a).
  • siRNA

    GCUUUCAUACUGACUACUAtt

    CGAGGACGACUUCAACUAUtt

    GAUUUUUGCGUUGAUUUUAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"