NovoPro
Cart 2
  • TJP3 Human  cDNA/ORF Clone

TJP3 Human cDNA/ORF Clone

Cat.#: 767910-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 250.0 USD

Availability: In Stock
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    tight junction protein 3
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    TJP3
  • Gene Type
    protein coding
  • Also Known as
    ZO3; ZO-3
  • Product Name
    TJP3(NM_001267561) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens tight junction protein 3 (TJP3), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    2787
  • Annotation
    This variant (2) differs in the 5' UTR and represents use of an alternate promoter, compared to variant 1, which results in a protein (isoform 2) with a longer and distinct N-terminus, compared to isoform 1.
  • siRNA

    GCGACUGAUUGAGAAGUCAtt

    GGAGAUCUCAUUCUACAGAtt

    GGACAGCAUGCGAACCUAUtt

  • DataSheet:
  • FAQs:
  • Product Name
    TJP3(NM_001267560) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens tight junction protein 3 (TJP3), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    2760
  • Annotation
    This variant (1) represents the longer transcript and encodes isoform 1.
  • siRNA

    GCGACUGAUUGAGAAGUCAtt

    GGAGAUCUCAUUCUACAGAtt

    GGACAGCAUGCGAACCUAUtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"