NovoPro
Cart 2
  • TDRD5 Human  cDNA/ORF Clone

TDRD5 Human cDNA/ORF Clone

Cat.#: 767909-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 504.9 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    tudor domain containing 5
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    TDRD5
  • Gene Type
    protein coding
  • Also Known as
    TUDOR3
  • Product Name
    TDRD5(NM_173533) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens tudor domain containing 5 (TDRD5), transcript variant 4, mRNA.
  • Synonyms
  • ORF length
    2946
  • Annotation
    This variant (4) has an alternate 5' UTR and lacks an in-frame coding exon compared to variant 1. The resulting isoform (2) lacks an internal segment, as compared to isoform 1. Variants 3 and 4 encode the same isoform (2).
  • siRNA

    CCUUUAGCUUUAUACACGAtt

    GCUGGUUUCUGAUCGAUAUtt

    CUAUAGCAGGGAUUCGUCAtt

  • DataSheet:
  • FAQs:
  • Product Name
    TDRD5(NM_001199092) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens tudor domain containing 5 (TDRD5), transcript variant 5, mRNA.
  • Synonyms
  • ORF length
    1611
  • Annotation
    This variant (5) lacks multiple exons from the 5' end and contains an alternate 5' exon, and lacks an in-frame coding exon compared to variant 1. The resulting isoform (3) has a shorter N-terminus and lacks an internal segment, as compared to isoform 1.
  • siRNA

    CCUUUAGCUUUAUACACGAtt

    GCUGGUUUCUGAUCGAUAUtt

    CUAUAGCAGGGAUUCGUCAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"