Cart 2
  • RELN Human  cDNA/ORF Clone

RELN Human cDNA/ORF Clone

Cat.#: 759747-1

  • Accession#:
  • Vector:
Optional Service:

Special Price Inquiry USD

Availability: Inquiry
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    reelin
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    RELN
  • Gene Type
    protein coding
  • Also Known as
    RL; ETL7; LIS2; PRO1598
  • Product Name
    RELN(NM_005045) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens reelin (RELN), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    10383
  • Annotation
    This variant (1) represents the longer transcript, and encodes the longer isoform (a).
  • siRNA

    CCAUGGACACUACCGGUUAtt

    CCUCGAUUCUUAAAGACGAtt

    GCAACCUUAUAAUAACGGUtt

  • DataSheet:
  • FAQs:
  • Product Name
    RELN(NM_173054) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens reelin (RELN), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    10377
  • Annotation
    This variant (2) lacks an in-frame, 6 nt microexon in the coding region compared to variant 1, resulting in an isoform (b) that is 2 aa shorter than isoform a.
  • siRNA

    CCAUGGACACUACCGGUUAtt

    CCUCGAUUCUUAAAGACGAtt

    GCAACCUUAUAAUAACGGUtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"