Cart 2
  • RANBP2 Human  cDNA/ORF Clone

RANBP2 Human cDNA/ORF Clone

Cat.#: 753570-1

  • Accession#:
  • Vector:
Optional Service:

Special Price Inquiry USD

Availability: Inquiry
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    RAN binding protein 2
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    RANBP2
  • Gene Type
    protein coding
  • Also Known as
    ANE1; TRP1; TRP2; ADANE; IIAE3; NUP358
  • Product Name
    RANBP2(XM_005264002) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens RAN binding protein 2 (RANBP2), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    9777
  • siRNA

    CCGUUUUGGUGAGUCAACAtt

    CCUGUAGAUUUGUCAACUAtt

    GAAUGUUCAAGAUCGAUUUtt

  • DataSheet:
  • FAQs:
  • Product Name
    RANBP2(XM_011511576) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens RAN binding protein 2 (RANBP2), transcript variant X6, mRNA.
  • Synonyms
  • ORF length
    9600
  • siRNA

    CCGUUUUGGUGAGUCAACAtt

    CCUGUAGAUUUGUCAACUAtt

    GAAUGUUCAAGAUCGAUUUtt

  • DataSheet:
  • FAQs:
  • Product Name
    RANBP2(XM_005264003) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens RAN binding protein 2 (RANBP2), transcript variant X3, mRNA.
  • Synonyms
  • ORF length
    9753
  • siRNA

    CCGUUUUGGUGAGUCAACAtt

    CCUGUAGAUUUGUCAACUAtt

    GAAUGUUCAAGAUCGAUUUtt

  • DataSheet:
  • FAQs:
  • Product Name
    RANBP2(XM_011511575) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens RAN binding protein 2 (RANBP2), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    9774
  • siRNA

    CCGUUUUGGUGAGUCAACAtt

    CCUGUAGAUUUGUCAACUAtt

    GAAUGUUCAAGAUCGAUUUtt

  • DataSheet:
  • FAQs:
  • Product Name
    RANBP2(XM_005264005) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens RAN binding protein 2 (RANBP2), transcript variant X5, mRNA.
  • Synonyms
  • ORF length
    9699
  • siRNA

    CCGUUUUGGUGAGUCAACAtt

    CCUGUAGAUUUGUCAACUAtt

    GAAUGUUCAAGAUCGAUUUtt

  • DataSheet:
  • FAQs:
  • Product Name
    RANBP2(XM_005264004) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens RAN binding protein 2 (RANBP2), transcript variant X4, mRNA.
  • Synonyms
  • ORF length
    9699
  • siRNA

    CCGUUUUGGUGAGUCAACAtt

    CCUGUAGAUUUGUCAACUAtt

    GAAUGUUCAAGAUCGAUUUtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"