NovoPro
Cart 2
  • MALAT1 Human  cDNA/ORF Clone

MALAT1 Human cDNA/ORF Clone

Cat.#: 767935-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 882.4 USD

Availability: In Stock
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    Metastasis associated lung adenocarcinoma transcript 1 (MALAT1) lncRNA
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    MALAT1
  • Gene Type
    non-protein coding
  • Also Known as
    NEAT2 (noncoding nuclear-enriched abundant transcript 2)
  • Vector Name
    pcDNA3.1(+)
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5428
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    None
  • Description
    This pcDNA™3.1(+) vector is designed for high-level, constitutive expression in a variety of mammalian cell lines. It contains a Geneticin® selectable marker and a forward-orientation multiple cloning site.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"