Cart 2
  • DYSF Human  cDNA/ORF Clone

DYSF Human cDNA/ORF Clone

Cat.#: 751755-1

  • Accession#:
  • Vector:
Optional Service:

Special Price Inquiry USD

Availability: Inquiry
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    dysferlin
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    DYSF
  • Gene Type
    protein coding
  • Also Known as
    MMD1; FER1L1; LGMD2B
  • Product Name
    DYSF(NM_001130977) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens dysferlin (DYSF), transcript variant 10, mRNA.
  • Synonyms
  • ORF length
    6264
  • Annotation
    This variant (10) differs in the 5' UTR and has multiple coding region differences, compared to variant 1. These differences cause translation initiation at an upstream AUG and a shorter isoform (10) with an alternate N-terminus compared to isoform 1.
  • siRNA

    GCGUGAACCCUGUAUGGAAtt

    GGACCUCCCUUCAACAUCAtt

    GGGUCGACCUAUUUCCGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    DYSF(NM_001130984) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens dysferlin (DYSF), transcript variant 5, mRNA.
  • Synonyms
  • ORF length
    6267
  • Annotation
    This variant (5) has multiple differences in the coding region but maintains the reading frame, compared to variant 1. This variant encodes isoform 5 which is shorter than isoform 1.
  • siRNA

    GCGUGAACCCUGUAUGGAAtt

    GGACCUCCCUUCAACAUCAtt

    GGGUCGACCUAUUUCCGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    DYSF(NM_001130455) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens dysferlin (DYSF), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    6246
  • Annotation
    This variant (2) has multiple differences in the coding region but maintains the reading frame, compared to variant 1. This variant encodes isoform 2 which is shorter than isoform 1.
  • siRNA

    GCGUGAACCCUGUAUGGAAtt

    GGACCUCCCUUCAACAUCAtt

    GGGUCGACCUAUUUCCGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    DYSF(NM_001130980) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens dysferlin (DYSF), transcript variant 13, mRNA.
  • Synonyms
  • ORF length
    6294
  • Annotation
    This variant (13) differs in the 5' UTR and has multiple coding region differences, compared to variant 1. These differences cause translation initiation at an upstream AUG and a shorter isoform (13) with an alternate N-terminus compared to isoform 1.
  • siRNA

    GCGUGAACCCUGUAUGGAAtt

    GGACCUCCCUUCAACAUCAtt

    GGGUCGACCUAUUUCCGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    DYSF(NM_001130986) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens dysferlin (DYSF), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    6204
  • Annotation
    This variant (3) has multiple differences in the coding region but maintains the reading frame, compared to variant 1. This variant encodes isoform 3 which is shorter than isoform 1.
  • siRNA

    GCGUGAACCCUGUAUGGAAtt

    GGACCUCCCUUCAACAUCAtt

    GGGUCGACCUAUUUCCGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    DYSF(NM_001130987) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens dysferlin (DYSF), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    6360
  • Annotation
    This variant (1) encodes the longest isoform (1).
  • siRNA

    GCGUGAACCCUGUAUGGAAtt

    GGACCUCCCUUCAACAUCAtt

    GGGUCGACCUAUUUCCGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    DYSF(NM_001130978) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens dysferlin (DYSF), transcript variant 11, mRNA.
  • Synonyms
  • ORF length
    6306
  • Annotation
    This variant (11) differs in the 5' UTR and has multiple coding region differences, compared to variant 1. These differences cause translation initiation at an upstream AUG and a shorter isoform (11) with an alternate N-terminus compared to isoform 1.
  • siRNA

    GCGUGAACCCUGUAUGGAAtt

    GGACCUCCCUUCAACAUCAtt

    GGGUCGACCUAUUUCCGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    DYSF(NM_003494) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens dysferlin (DYSF), transcript variant 8, mRNA.
  • Synonyms
  • ORF length
    6243
  • Annotation
    This variant (8) differs in the 5' UTR and has multiple coding region differences, compared to variant 1. These differences cause translation initiation at an upstream AUG and a shorter isoform (8) with an alternate N-terminus compared to isoform 1.
  • siRNA

    GCGUGAACCCUGUAUGGAAtt

    GGACCUCCCUUCAACAUCAtt

    GGGUCGACCUAUUUCCGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    DYSF(NM_001130979) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens dysferlin (DYSF), transcript variant 12, mRNA.
  • Synonyms
  • ORF length
    6336
  • Annotation
    This variant (12) differs in the 5' UTR and has multiple coding region differences, compared to variant 1. These differences cause translation initiation at an upstream AUG and a shorter isoform (12) with an alternate N-terminus compared to isoform 1.
  • siRNA

    GCGUGAACCCUGUAUGGAAtt

    GGACCUCCCUUCAACAUCAtt

    GGGUCGACCUAUUUCCGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    DYSF(NM_001130981) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens dysferlin (DYSF), transcript variant 14, mRNA.
  • Synonyms
  • ORF length
    6357
  • Annotation
    This variant (14) differs in the 5' UTR and has multiple coding region differences, compared to variant 1. These differences cause translation initiation at an upstream AUG and a shorter isoform (14) with an alternate N-terminus compared to isoform 1.
  • siRNA

    GCGUGAACCCUGUAUGGAAtt

    GGACCUCCCUUCAACAUCAtt

    GGGUCGACCUAUUUCCGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    DYSF(NM_001130985) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens dysferlin (DYSF), transcript variant 4, mRNA.
  • Synonyms
  • ORF length
    6297
  • Annotation
    This variant (4) has multiple differences in the coding region but maintains the reading frame, compared to variant 1. This variant encodes isoform 4 which is shorter than isoform 1.
  • siRNA

    GCGUGAACCCUGUAUGGAAtt

    GGACCUCCCUUCAACAUCAtt

    GGGUCGACCUAUUUCCGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    DYSF(NM_001130982) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens dysferlin (DYSF), transcript variant 7, mRNA.
  • Synonyms
  • ORF length
    6339
  • Annotation
    This variant (7) has multiple differences in the coding region but maintains the reading frame, compared to variant 1. This variant encodes isoform 7 which is shorter than isoform 1.
  • siRNA

    GCGUGAACCCUGUAUGGAAtt

    GGACCUCCCUUCAACAUCAtt

    GGGUCGACCUAUUUCCGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    DYSF(NM_001130983) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens dysferlin (DYSF), transcript variant 6, mRNA.
  • Synonyms
  • ORF length
    6309
  • Annotation
    This variant (6) has multiple differences in the coding region but maintains the reading frame, compared to variant 1. This variant encodes isoform 6 which is shorter than isoform 1.
  • siRNA

    GCGUGAACCCUGUAUGGAAtt

    GGACCUCCCUUCAACAUCAtt

    GGGUCGACCUAUUUCCGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    DYSF(NM_001130976) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens dysferlin (DYSF), transcript variant 9, mRNA.
  • Synonyms
  • ORF length
    6201
  • Annotation
    This variant (9) differs in the 5' UTR and has multiple coding region differences, compared to variant 1. These differences cause translation initiation at an upstream AUG and a shorter isoform (9) with an alternate N-terminus compared to isoform 1.
  • siRNA

    GCGUGAACCCUGUAUGGAAtt

    GGACCUCCCUUCAACAUCAtt

    GGGUCGACCUAUUUCCGAAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"