NovoPro
Cart 2
  • COBL Human  cDNA/ORF Clone

COBL Human cDNA/ORF Clone

Cat.#: 767772-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 886.3 USD

Availability: 3-4 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    cordon-bleu WH2 repeat protein
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    COBL
  • Gene Type
    protein coding
  • Product Name
    COBL(NM_001346441) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens cordon-bleu WH2 repeat protein (COBL), transcript variant 4, mRNA.
  • Synonyms
  • ORF length
    3693
  • Annotation
    This variant (4) lacks an alternate in-frame exon in the 3' coding region compared to variant 1. The encoded isoform (d) is shorter than isoform a.
  • siRNA
  • DataSheet:
  • FAQs:
  • Product Name
    COBL(XM_011515240) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens cordon-bleu WH2 repeat protein (COBL), transcript variant X10, mRNA.
  • Synonyms
  • ORF length
    3720
  • siRNA

    CAGACAACCUAAAUGCAAAtt

    AGCACGGCCUCACAACGUAtt

    GAGAUGCGAUGUUACGACAtt

    CCCUGAAUGUGCAUACUGUtt

  • DataSheet:
  • FAQs:
  • Product Name
    COBL(XM_011515234) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens cordon-bleu WH2 repeat protein (COBL), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    4077
  • siRNA

    CAGACAACCUAAAUGCAAAtt

    AGCACGGCCUCACAACGUAtt

    GAGAUGCGAUGUUACGACAtt

    CCCUGAAUGUGCAUACUGUtt

  • DataSheet:
  • FAQs:
  • Product Name
    COBL(NM_001287436) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens cordon-bleu WH2 repeat protein (COBL), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    3816
  • Annotation
    This variant (1) represents the longest transcript and encodes the longest isoform (a).
  • siRNA

    CAGACAACCUAAAUGCAAAtt

    AGCACGGCCUCACAACGUAtt

    GAGAUGCGAUGUUACGACAtt

    CCCUGAAUGUGCAUACUGUtt

  • DataSheet:
  • FAQs:
  • Product Name
    COBL(XM_011515238) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens cordon-bleu WH2 repeat protein (COBL), transcript variant X8, mRNA.
  • Synonyms
  • ORF length
    3813
  • siRNA

    CAGACAACCUAAAUGCAAAtt

    AGCACGGCCUCACAACGUAtt

    GAGAUGCGAUGUUACGACAtt

    CCCUGAAUGUGCAUACUGUtt

  • DataSheet:
  • FAQs:
  • Product Name
    COBL(XM_011515239) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens cordon-bleu WH2 repeat protein (COBL), transcript variant X9, mRNA.
  • Synonyms
  • ORF length
    3765
  • siRNA

    CAGACAACCUAAAUGCAAAtt

    AGCACGGCCUCACAACGUAtt

    GAGAUGCGAUGUUACGACAtt

    CCCUGAAUGUGCAUACUGUtt

  • DataSheet:
  • FAQs:
  • Product Name
    COBL(NM_001346444) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens cordon-bleu WH2 repeat protein (COBL), transcript variant 7, mRNA.
  • Synonyms
  • ORF length
    1410
  • Annotation
    This variant (7) lacks several 3' exons but contains an alternate 3' terminal exon, and it thus differs in its 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (g) has a distinct C-terminus and is shorter than isoform a.
  • siRNA
  • DataSheet:
  • FAQs:
  • Product Name
    COBL(XM_011515236) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens cordon-bleu WH2 repeat protein (COBL), transcript variant X5, mRNA.
  • Synonyms
  • ORF length
    3936
  • siRNA

    CAGACAACCUAAAUGCAAAtt

    AGCACGGCCUCACAACGUAtt

    GAGAUGCGAUGUUACGACAtt

    CCCUGAAUGUGCAUACUGUtt

  • DataSheet:
  • FAQs:
  • Product Name
    COBL(XM_011515235) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens cordon-bleu WH2 repeat protein (COBL), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    4032
  • siRNA

    CAGACAACCUAAAUGCAAAtt

    AGCACGGCCUCACAACGUAtt

    GAGAUGCGAUGUUACGACAtt

    CCCUGAAUGUGCAUACUGUtt

  • DataSheet:
  • FAQs:
  • Product Name
    COBL(NM_001346443) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens cordon-bleu WH2 repeat protein (COBL), transcript variant 6, mRNA.
  • Synonyms
  • ORF length
    3522
  • Annotation
    This variant (6) lacks two alternate in-frame exons in the coding region compared to variant 1. The encoded isoform (f) is shorter than isoform a.
  • siRNA
  • DataSheet:
  • FAQs:
  • Product Name
    COBL(XM_005271750) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens cordon-bleu WH2 repeat protein (COBL), transcript variant X3, mRNA.
  • Synonyms
  • ORF length
    4002
  • siRNA

    CAGACAACCUAAAUGCAAAtt

    AGCACGGCCUCACAACGUAtt

    GAGAUGCGAUGUUACGACAtt

    CCCUGAAUGUGCAUACUGUtt

  • DataSheet:
  • FAQs:
  • Product Name
    COBL(NM_001346442) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens cordon-bleu WH2 repeat protein (COBL), transcript variant 5, mRNA.
  • Synonyms
  • ORF length
    3645
  • Annotation
    This variant (5) lacks an alternate in-frame exon in the 5' coding region compared to variant 1. The encoded isoform (e) is shorter than isoform a.
  • siRNA
  • DataSheet:
  • FAQs:
  • Product Name
    COBL(XM_011515241) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens cordon-bleu WH2 repeat protein (COBL), transcript variant X14, mRNA.
  • Synonyms
  • ORF length
    3144
  • siRNA

    CAGACAACCUAAAUGCAAAtt

    AGCACGGCCUCACAACGUAtt

    GAGAUGCGAUGUUACGACAtt

  • DataSheet:
  • FAQs:
  • Product Name
    COBL(XM_011515237) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens cordon-bleu WH2 repeat protein (COBL), transcript variant X6, mRNA.
  • Synonyms
  • ORF length
    3906
  • siRNA

    CAGACAACCUAAAUGCAAAtt

    AGCACGGCCUCACAACGUAtt

    GAGAUGCGAUGUUACGACAtt

    CCCUGAAUGUGCAUACUGUtt

  • DataSheet:
  • FAQs:
  • Product Name
    COBL(XM_005271751) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens cordon-bleu WH2 repeat protein (COBL), transcript variant X4, mRNA.
  • Synonyms
  • ORF length
    3957
  • siRNA

    CAGACAACCUAAAUGCAAAtt

    AGCACGGCCUCACAACGUAtt

    GAGAUGCGAUGUUACGACAtt

    CCCUGAAUGUGCAUACUGUtt

  • DataSheet:
  • FAQs:
  • Product Name
    COBL(NM_001287438) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens cordon-bleu WH2 repeat protein (COBL), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    1140
  • Annotation
    This variant (3) lacks several 3' exons but contains an alternate 3' terminal exon, and it thus differs in its 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (c) has a distinct C-terminus and is shorter than isoform a.
  • siRNA

    CCCUGAAUGUGCAUACUGUtt

  • DataSheet:
  • FAQs:
  • Product Name
    COBL(XM_017011898) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens cordon-bleu WH2 repeat protein (COBL), transcript variant X7, mRNA.
  • Synonyms
  • ORF length
    3831
  • siRNA

    CAGACAACCUAAAUGCAAAtt

    AGCACGGCCUCACAACGUAtt

    GAGAUGCGAUGUUACGACAtt

    CCCUGAAUGUGCAUACUGUtt

  • DataSheet:
  • FAQs:
  • Product Name
    COBL(NM_015198) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens cordon-bleu WH2 repeat protein (COBL), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    3786
  • Annotation
    This variant (2) lacks an alternate in-frame exon in the central coding region, and uses an alternate in-frame splice site in the 3' coding region, compared to variant 1. The encoded isoform (b) is shorter than isoform a.
  • siRNA

    CAGACAACCUAAAUGCAAAtt

    AGCACGGCCUCACAACGUAtt

    GAGAUGCGAUGUUACGACAtt

    CCCUGAAUGUGCAUACUGUtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"