NovoPro
Cart 2
  • CEP152 Human  cDNA/ORF Clone

CEP152 Human cDNA/ORF Clone

Cat.#: 767769-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 1,021.7 USD

Availability: 3-4 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    centrosomal protein 152
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    CEP152
  • Gene Type
    protein coding
  • Also Known as
    MCPH4; MCPH9; SCKL5
  • Product Name
    CEP152(XM_017022014) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens centrosomal protein 152 (CEP152), transcript variant X3, mRNA.
  • Synonyms
  • ORF length
    4257
  • siRNA

    GAAUCAGGAUGCAUGCAUAtt

    GAGUUGGAUAAGUUGAAUAtt

    CUUUCGCGAUUCUAAUGAAtt

    GCAUAUAACCUUUCGCGAUtt

    GGUAGUUGCAAGCACCUAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    CEP152(NM_001194998) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens centrosomal protein 152 (CEP152), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    5133
  • Annotation
    This variant (1) represents the longer variant and encodes the longer isoform (1).
  • siRNA

    GAAUCAGGAUGCAUGCAUAtt

    GAGUUGGAUAAGUUGAAUAtt

    GGUUUGGAACCGUAUAAUAtt

    CUUUCGCGAUUCUAAUGAAtt

    GCAUAUAACCUUUCGCGAUtt

    GGUAGUUGCAAGCACCUAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    CEP152(XM_011521379) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens centrosomal protein 152 (CEP152), transcript variant X11, mRNA.
  • Synonyms
  • ORF length
    4026
  • siRNA

    GAAUCAGGAUGCAUGCAUAtt

    GAGUUGGAUAAGUUGAAUAtt

    GGUUUGGAACCGUAUAAUAtt

    CUUUCGCGAUUCUAAUGAAtt

    GCAUAUAACCUUUCGCGAUtt

    GGUAGUUGCAAGCACCUAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    CEP152(XM_011521374) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens centrosomal protein 152 (CEP152), transcript variant X4, mRNA.
  • Synonyms
  • ORF length
    4206
  • siRNA

    GCUGAGGACUUACCACUUUtt

    GAGUUGGAUAAGUUGAAUAtt

    GGUUUGGAACCGUAUAAUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    CEP152(XM_011521381) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens centrosomal protein 152 (CEP152), transcript variant X12, mRNA.
  • Synonyms
  • ORF length
    3168
  • siRNA

    GAAUCAGGAUGCAUGCAUAtt

    GAGUUGGAUAAGUUGAAUAtt

    CUUUCGCGAUUCUAAUGAAtt

    GCAUAUAACCUUUCGCGAUtt

    GGUAGUUGCAAGCACCUAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    CEP152(NM_014985) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens centrosomal protein 152 (CEP152), transcript variant 2, mRNA.
  • Synonyms
    XM_034904  
  • ORF length
    4965
  • Annotation
    This variant (2) lacks an in-frame exon in the coding region, compared to variant 1. It encodes isoform 2, which is shorter than isoform 1.
  • siRNA

    GAAUCAGGAUGCAUGCAUAtt

    GAGUUGGAUAAGUUGAAUAtt

    GGUUUGGAACCGUAUAAUAtt

    CUUUCGCGAUUCUAAUGAAtt

    GCAUAUAACCUUUCGCGAUtt

    GGUAGUUGCAAGCACCUAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    CEP152(XM_011521373) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens centrosomal protein 152 (CEP152), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    5103
  • siRNA

    GAAUCAGGAUGCAUGCAUAtt

    GAGUUGGAUAAGUUGAAUAtt

    GGUUUGGAACCGUAUAAUAtt

    CUUUCGCGAUUCUAAUGAAtt

    GCAUAUAACCUUUCGCGAUtt

    GGUAGUUGCAAGCACCUAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    CEP152(XM_011521378) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens centrosomal protein 152 (CEP152), transcript variant X10, mRNA.
  • Synonyms
  • ORF length
    4089
  • siRNA

    GCUGAGGACUUACCACUUUtt

    GAGUUGGAUAAGUUGAAUAtt

    GGUUUGGAACCGUAUAAUAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pCR-XL-TOPO
  • primers
    T7: TAATACGACTCACTATAGGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    3519
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Zeocin
  • Protein Tag
    None
  • Description
    Parental vector for TOPO® TA cloning of long PCR products.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"