NovoPro
Cart 2
  • CDON Human  cDNA/ORF Clones

CDON Human cDNA/ORF Clones

Cat.#: 767767-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 690.0 USD

Availability: 1 week
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    cell adhesion associated, oncogene regulated
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    CDON
  • Gene Type
    protein coding
  • Also Known as
    CDO; CDON1; HPE11; ORCAM
  • Product Name
    CDON(NM_016952) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens cell adhesion associated, oncogene regulated (CDON), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    3795
  • Annotation
    This variant (2) uses an alternate in-frame splice site in the 3' coding region, compared to variant 1. This results in a shorter protein (isoform 2), compared to isoform 1.
  • siRNA

    GGAAGUUCGUAGUUUAGAAtt

    CGAAAAUCACAGUUAUCAAtt

    CGUACAUUCCAUCAAGUAAtt

  • DataSheet:
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Antibodies
  • cDNA Clones

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"