NovoPro
Cart 2
  • CDK14 Human  cDNA/ORF Clone

CDK14 Human cDNA/ORF Clone

Cat.#: 767768-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 175.3 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    cyclin dependent kinase 14
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    CDK14
  • Gene Type
    protein coding
  • Also Known as
    PFTK1; PFTAIRE1
  • Product Name
    CDK14(NM_001287137) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens cyclin dependent kinase 14 (CDK14), transcript variant 4, mRNA.
  • Synonyms
  • ORF length
    1023
  • Annotation
    This variant (4) contains alternate 5' exon structure and it thus differs in the 5' UTR and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (d) has a distinct N-terminus and is shorter than isoform a.
  • siRNA

    CCAACGAAGUGGUUACCUUtt

    GGAAUGGACUCAGUGAUCAtt

    GGAUCAACUUGAACGAAUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    CDK14(NM_012395) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens cyclin dependent kinase 14 (CDK14), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    1356
  • Annotation
    This variant (2) contains alternate 5' exon structure and it thus differs in the 5' UTR and 5' coding region, compared to variant 1. The encoded isoform (b) has a distinct N-terminus and is shorter than isoform a.
  • siRNA

    CCAACGAAGUGGUUACCUUtt

    GGAAUGGACUCAGUGAUCAtt

    GGAUCAACUUGAACGAAUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    CDK14(NM_001287135) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens cyclin dependent kinase 14 (CDK14), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    1410
  • Annotation
    This variant (1) represents the longest transcript and encodes the longest isoform (a).
  • siRNA

    CCAACGAAGUGGUUACCUUtt

    GGAAUGGACUCAGUGAUCAtt

    GGAUCAACUUGAACGAAUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    CDK14(XM_005250436) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens cyclin-dependent kinase 14 (CDK14), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    1353
  • siRNA

    CCAACGAAGUGGUUACCUUtt

    GGAAUGGACUCAGUGAUCAtt

    GGAUCAACUUGAACGAAUAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"