NovoPro
Cart 2
  • CCDC169-SOHLH2 Human  cDNA/ORF Clones

CCDC169-SOHLH2 Human cDNA/ORF Clones

Cat.#: 767766-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 258.6 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    CCDC169-SOHLH2 readthrough
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    CCDC169-SOHLH2
  • Gene Type
    protein coding
  • Also Known as
    C13orf38-SOHLH2
  • Product Name
    CCDC169-SOHLH2(NM_001198910) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens CCDC169-SOHLH2 readthrough (CCDC169-SOHLH2), mRNA.
  • Synonyms
  • ORF length
    1509
  • siRNA

    GCAAUGGGCUUGAAUUAAAtt

  • DataSheet:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"