NovoPro
Cart 2
  • CCDC129 Human  cDNA/ORF Clone

CCDC129 Human cDNA/ORF Clone

Cat.#: 767764-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 759.6 USD

Availability: 3-4 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    coiled-coil domain containing 129
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    CCDC129
  • Gene Type
    protein coding
  • Product Name
    CCDC129(NM_001257967) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens coiled-coil domain containing 129 (CCDC129), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    3165
  • Annotation
    This variant (1) encodes the longest isoform (1).
  • siRNA

    CAGACUCAUUUGAAAUGGAtt

    CAAGCACAGUGAAAUCACAtt

    CGGGAGUAUUUAGAAGAAAtt

    CCAAAUCCGUCUCUCUAGAtt

    CAACCACAGCUUACUCGUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    CCDC129(NM_001257968) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens coiled-coil domain containing 129 (CCDC129), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    3189
  • Annotation
    This variant (3) differs in the 5' and 3' UTRs and has multiple coding difference, including use of an alternate translation initiation site, compared to variant 1. The encoded isoform (3) contains a distinct N- and C-terminus.
  • siRNA

    CAGACUCAUUUGAAAUGGAtt

    CAAGCACAGUGAAAUCACAtt

    CGGGAGUAUUUAGAAGAAAtt

    CCAAAUCCGUCUCUCUAGAtt

    CAACCACAGCUUACUCGUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    CCDC129(NM_194300) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens coiled-coil domain containing 129 (CCDC129), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    3135
  • Annotation
    This variant (2) differs in the 5' UTR and coding region, compared to variant 1. These differences cause translation initiation at a downstream AUG and result in an isoform (2) with a shorter N-terminus, compared to isoform 1.
  • siRNA

    CAGACUCAUUUGAAAUGGAtt

    CAAGCACAGUGAAAUCACAtt

    CGGGAGUAUUUAGAAGAAAtt

    CCAAAUCCGUCUCUCUAGAtt

    CAACCACAGCUUACUCGUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    CCDC129(XM_017011872) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens coiled-coil domain containing 129 (CCDC129), transcript variant X3, mRNA.
  • Synonyms
  • ORF length
    3132
  • siRNA

    CAGACUCAUUUGAAAUGGAtt

    CAAGCACAGUGAAAUCACAtt

    CGGGAGUAUUUAGAAGAAAtt

    CCAAAUCCGUCUCUCUAGAtt

    CAACCACAGCUUACUCGUAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pCR4-TOPO
  • primers
    M13 fwd: GTAAAACGACGGCCAGT
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    3956
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    None
  • Description
    TOPO Cloning vector with ampicillin resistance in bacteria.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"