NovoPro
Cart 2
  • CASR Human  cDNA/ORF Clones

CASR Human cDNA/ORF Clones

Cat.#: 767763-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 667.3 USD

Availability: 1 week
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    calcium sensing receptor
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    CASR
  • Gene Type
    protein coding
  • Also Known as
    CAR; FHH; FIH; HHC; EIG8; HHC1; NSHPT; PCAR1; GPRC2A; HYPOC1
  • Product Name
    CASR(NM_001178065) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens calcium sensing receptor (CASR), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    3267
  • Annotation
    This variant (1) encodes the longer isoform (1).
  • siRNA

    CAUCUAAACUUUACAAACAtt

    CGCAUUUACGGAUAUCCUAtt

    CCAUUGGAUUCGCUCUGAAtt

  • DataSheet:
  • Product Name
    CASR(NM_000388) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens calcium sensing receptor (CASR), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    3237
  • Annotation
    This variant (2) has an alternate 5' UTR exon and lacks an in-frame segment in the CDS, as compared to variant 1. The resulting isoform (2) is shorter and lacks an internal segment, as compared to isoform 1.
  • siRNA

    CAUCUAAACUUUACAAACAtt

    CGCAUUUACGGAUAUCCUAtt

    CCAUUGGAUUCGCUCUGAAtt

  • DataSheet:
  • Product Name
    CASR(XM_005247837) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens calcium sensing receptor (CASR), transcript variant X4, mRNA.
  • Synonyms
  • ORF length
    2754
  • siRNA

    CAUCUAAACUUUACAAACAtt

    CGCAUUUACGGAUAUCCUAtt

    CCAUUGGAUUCGCUCUGAAtt

  • DataSheet:
  • Product Name
    CASR(XM_017007325) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens calcium sensing receptor (CASR), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    3237
  • siRNA

    CAUCUAAACUUUACAAACAtt

    CGCAUUUACGGAUAUCCUAtt

    CCAUUGGAUUCGCUCUGAAtt

  • DataSheet:
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"