NovoPro
Cart 2
  • CACNA1E Human  cDNA/ORF Clone

CACNA1E Human cDNA/ORF Clone

Cat.#: 767761-1

  • Accession#:
  • Vector:
Optional Service:

Special Price Inquiry USD

Availability: Inquiry
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    calcium voltage-gated channel subunit alpha1 E
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    CACNA1E
  • Gene Type
    protein coding
  • Also Known as
    BII; CACH6; gm139; Cav2.3; CACNL1A6
  • Product Name
    CACNA1E(XM_017002249) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens calcium voltage-gated channel subunit alpha1 E (CACNA1E), transcript variant X7, mRNA.
  • Synonyms
  • ORF length
    7248
  • siRNA

    CUGUUUCACCGUCAACAGAtt

    GGAUGCAGGUAUUUGGAAAtt

    GCCGCAUCCAUUACACUGAtt

    GCGUCAGGGCUAUACCAUAtt

    GGGCUAUACCAUACGCAUUtt

  • DataSheet:
  • FAQs:
  • Product Name
    CACNA1E(NM_001205293) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens calcium voltage-gated channel subunit alpha1 E (CACNA1E), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    6942
  • Annotation
    This variant (1) represents the longest transcript, and encodes the longest isoform (1, also known as alpha-1E).
  • siRNA

    CUGUUUCACCGUCAACAGAtt

    GGAUGCAGGUAUUUGGAAAtt

    GCCGCAUCCAUUACACUGAtt

    GCGUCAGGGCUAUACCAUAtt

    GGGCUAUACCAUACGCAUUtt

  • DataSheet:
  • FAQs:
  • Product Name
    CACNA1E(XM_017002247) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens calcium voltage-gated channel subunit alpha1 E (CACNA1E), transcript variant X5, mRNA.
  • Synonyms
  • ORF length
    7320
  • siRNA

    CUGUUUCACCGUCAACAGAtt

    GGAUGCAGGUAUUUGGAAAtt

    GCCGCAUCCAUUACACUGAtt

    GCGUCAGGGCUAUACCAUAtt

    GGGCUAUACCAUACGCAUUtt

  • DataSheet:
  • FAQs:
  • Product Name
    CACNA1E(XM_017002245) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens calcium voltage-gated channel subunit alpha1 E (CACNA1E), transcript variant X3, mRNA.
  • Synonyms
  • ORF length
    7365
  • siRNA

    CUGUUUCACCGUCAACAGAtt

    GGAUGCAGGUAUUUGGAAAtt

    GCCGCAUCCAUUACACUGAtt

    GCGUCAGGGCUAUACCAUAtt

    GGGCUAUACCAUACGCAUUtt

  • DataSheet:
  • FAQs:
  • Product Name
    CACNA1E(XM_017002246) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens calcium voltage-gated channel subunit alpha1 E (CACNA1E), transcript variant X4, mRNA.
  • Synonyms
  • ORF length
    7365
  • siRNA

    CUGUUUCACCGUCAACAGAtt

    GGAUGCAGGUAUUUGGAAAtt

    GCGUCAGGGCUAUACCAUAtt

    GGGCUAUACCAUACGCAUUtt

  • DataSheet:
  • FAQs:
  • Product Name
    CACNA1E(XM_017002243) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens calcium voltage-gated channel subunit alpha1 E (CACNA1E), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    7377
  • siRNA

    CUGUUUCACCGUCAACAGAtt

    GGAUGCAGGUAUUUGGAAAtt

    GCCGCAUCCAUUACACUGAtt

    GCGUCAGGGCUAUACCAUAtt

    GGGCUAUACCAUACGCAUUtt

  • DataSheet:
  • FAQs:
  • Product Name
    CACNA1E(XM_017002250) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens calcium voltage-gated channel subunit alpha1 E (CACNA1E), transcript variant X8, mRNA.
  • Synonyms
  • ORF length
    7191
  • siRNA

    CUGUUUCACCGUCAACAGAtt

    GGAUGCAGGUAUUUGGAAAtt

    GCCGCAUCCAUUACACUGAtt

    GCGUCAGGGCUAUACCAUAtt

    GGGCUAUACCAUACGCAUUtt

  • DataSheet:
  • FAQs:
  • Product Name
    CACNA1E(NM_000721) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens calcium voltage-gated channel subunit alpha1 E (CACNA1E), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    6813
  • Annotation
    This variant (3) is missing an in-frame coding exon compared to variant 1. This results in a shorter isoform (3, also known as alpha-1E-3) missing an internal protein segment compared to isoform 1.
  • siRNA

    CUGUUUCACCGUCAACAGAtt

    GGAUGCAGGUAUUUGGAAAtt

    GCCGCAUCCAUUACACUGAtt

    GCGUCAGGGCUAUACCAUAtt

    GGGCUAUACCAUACGCAUUtt

  • DataSheet:
  • FAQs:
  • Product Name
    CACNA1E(NM_001205294) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens calcium voltage-gated channel subunit alpha1 E (CACNA1E), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    6756
  • Annotation
    This variant (2) is missing two non-consecutive in-frame coding exons compared to variant 1. This results in a shorter isoform (2, also known as alpha-1E-1) missing two internal protein segments compared to isoform 1.
  • siRNA

    CUGUUUCACCGUCAACAGAtt

    GGAUGCAGGUAUUUGGAAAtt

    GCCGCAUCCAUUACACUGAtt

    GCGUCAGGGCUAUACCAUAtt

    GGGCUAUACCAUACGCAUUtt

  • DataSheet:
  • FAQs:
  • Product Name
    CACNA1E(XM_017002248) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens calcium voltage-gated channel subunit alpha1 E (CACNA1E), transcript variant X6, mRNA.
  • Synonyms
  • ORF length
    7311
  • siRNA

    CUGUUUCACCGUCAACAGAtt

    GCCGCAUCCAUUACACUGAtt

    GCGUCAGGGCUAUACCAUAtt

    GGGCUAUACCAUACGCAUUtt

  • DataSheet:
  • FAQs:
  • Product Name
    CACNA1E(XM_017002244) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens calcium voltage-gated channel subunit alpha1 E (CACNA1E), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    7377
  • siRNA

    CUGUUUCACCGUCAACAGAtt

    GGAUGCAGGUAUUUGGAAAtt

    GCGUCAGGGCUAUACCAUAtt

    GGGCUAUACCAUACGCAUUtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"