NovoPro
Cart 2
  • CACNA1A Human  cDNA/ORF Clones

CACNA1A Human cDNA/ORF Clones

Cat.#: 767759-1

  • Accession#:
  • Vector:
Optional Service:

Special Price Inquiry USD

Availability: Inquiry
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    calcium voltage-gated channel subunit alpha1 A
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    CACNA1A
  • Gene Type
    protein coding
  • Also Known as
    BI; EA2; FHM; MHP; APCA; HPCA; MHP1; SCA6; CAV2.1; EIEE42; CACNL1A4
  • Product Name
    CACNA1A(NM_000068) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens calcium voltage-gated channel subunit alpha1 A (CACNA1A), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    6801
  • Annotation
    This variant (1) uses an alternate splice site in the 3' coding region that results in a frameshift, compared to variant 2. The resulting isoform (1) has a shorter and distinct C-terminus that does not include the polyglutamine tract, compared to isoform 2.
  • siRNA

    GCCCUCAGGUUAUUGCGUAtt

    CGUCGUACAAGUGAACAAAtt

    CCGAUAUCCUCGUGACUGAtt

  • DataSheet:
  • Product Name
    CACNA1A(NM_001127222) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens calcium voltage-gated channel subunit alpha1 A (CACNA1A), transcript variant 4, mRNA.
  • Synonyms
  • ORF length
    7521
  • Annotation
    This variant (4) uses two alternate in-frame splice sites and lacks an alternate in-frame exon, compared to variant 2. The resulting isoform (4) differs at three internal regions, compared to isoform 2, and includes the polyglutamine tract near the C-terminus.
  • siRNA

    GCCCUCAGGUUAUUGCGUAtt

    CGUCGUACAAGUGAACAAAtt

    CCGAUAUCCUCGUGACUGAtt

  • DataSheet:
  • Product Name
    CACNA1A(NM_023035) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens calcium voltage-gated channel subunit alpha1 A (CACNA1A), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    7539
  • Annotation
    This variant (2) represents the longest transcript and encodes the longest isoform (2). This variant includes a (CAG)n-repeat in the coding region, resulting in a polyglutamine tract near the C-terminus.
  • siRNA

    GCCCUCAGGUUAUUGCGUAtt

    CGUCGUACAAGUGAACAAAtt

    CCGAUAUCCUCGUGACUGAtt

  • DataSheet:
  • Product Name
    CACNA1A(NM_001174080) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens calcium voltage-gated channel subunit alpha1 A (CACNA1A), transcript variant 5, mRNA.
  • Synonyms
  • ORF length
    6792
  • Annotation
    This variant (5) uses two alternate splice sites, compared to variant 2. The resulting isoform (5) lacks an internal 3-aa segment and has a shorter and distinct C-terminus that does not include the polyglutamine tract, compared to isoform 2.
  • siRNA

    GCCCUCAGGUUAUUGCGUAtt

    CGUCGUACAAGUGAACAAAtt

    CCGAUAUCCUCGUGACUGAtt

  • DataSheet:
  • Product Name
    CACNA1A(NM_001127221) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens calcium voltage-gated channel subunit alpha1 A (CACNA1A), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    6786
  • Annotation
    This variant (3) uses two alternate splice sites, lacks two alternate exons, and includes an additional exon, compared to variant 2. The resulting isoform (3) differs at 3 internal regions and has a shorter and distinct C-terminus that does not include the polyglutamine tract, compared to isoform 2.
  • siRNA

    GCCCUCAGGUUAUUGCGUAtt

    CGUCGUACAAGUGAACAAAtt

    CCGAUAUCCUCGUGACUGAtt

  • DataSheet:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"