NovoPro
Cart 2
  • CABIN1 Human  cDNA/ORF Clone

CABIN1 Human cDNA/ORF Clone

Cat.#: 767757-1

  • Accession#:
  • Vector:
Optional Service:

Special Price Inquiry USD

Availability: Inquiry
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    calcineurin binding protein 1
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    CABIN1
  • Gene Type
    protein coding
  • Also Known as
    CAIN; PPP3IN; KB-318B8.7
  • Product Name
    CABIN1(XM_005261416) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens calcineurin binding protein 1 (CABIN1), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    6753
  • siRNA

    GGAUUGAUUUGUCGGACUAtt

    GGAUUGCCGGUACAGCAAAtt

    GCGAUUCUAUGUGCGAGUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    CABIN1(XM_005261417) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens calcineurin binding protein 1 (CABIN1), transcript variant X4, mRNA.
  • Synonyms
  • ORF length
    6678
  • siRNA

    GGAUUGAUUUGUCGGACUAtt

    GGAUUGCCGGUACAGCAAAtt

    GCGAUUCUAUGUGCGAGUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    CABIN1(XM_011530026) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens calcineurin binding protein 1 (CABIN1), transcript variant X10, mRNA.
  • Synonyms
  • ORF length
    6573
  • siRNA

    GGAUUGAUUUGUCGGACUAtt

    GGAUUGCCGGUACAGCAAAtt

    GCGAUUCUAUGUGCGAGUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    CABIN1(XM_017028680) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens calcineurin binding protein 1 (CABIN1), transcript variant X5, mRNA.
  • Synonyms
  • ORF length
    6666
  • siRNA

    GGAUUGAUUUGUCGGACUAtt

    GGAUUGCCGGUACAGCAAAtt

    GCGAUUCUAUGUGCGAGUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    CABIN1(XM_017028683) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens calcineurin binding protein 1 (CABIN1), transcript variant X12, mRNA.
  • Synonyms
  • ORF length
    6426
  • siRNA

    GGAUUGAUUUGUCGGACUAtt

    GGAUUGCCGGUACAGCAAAtt

    GCGAUUCUAUGUGCGAGUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    CABIN1(NM_012295) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens calcineurin binding protein 1 (CABIN1), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    6663
  • Annotation
    This variant (1) represents the longest transcript and encodes the longer isoform (a). Both variants 1 and 2 encode the same isoform (a).
  • siRNA

    GGAUUGAUUUGUCGGACUAtt

    GGAUUGCCGGUACAGCAAAtt

    GCGAUUCUAUGUGCGAGUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    CABIN1(XM_011530029) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens calcineurin binding protein 1 (CABIN1), transcript variant X13, mRNA.
  • Synonyms
  • ORF length
    6171
  • siRNA

    GGAUUGAUUUGUCGGACUAtt

    GGAUUGCCGGUACAGCAAAtt

    GCGAUUCUAUGUGCGAGUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    CABIN1(XM_006724180) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens calcineurin binding protein 1 (CABIN1), transcript variant X8, mRNA.
  • Synonyms
  • ORF length
    6591
  • siRNA

    GGAUUGAUUUGUCGGACUAtt

    GGAUUGCCGGUACAGCAAAtt

    GCGAUUCUAUGUGCGAGUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    CABIN1(XM_017028682) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens calcineurin binding protein 1 (CABIN1), transcript variant X11, mRNA.
  • Synonyms
  • ORF length
    6441
  • siRNA

    GGAUUGAUUUGUCGGACUAtt

    GGAUUGCCGGUACAGCAAAtt

    GCGAUUCUAUGUGCGAGUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    CABIN1(NM_001201429) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens calcineurin binding protein 1 (CABIN1), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    6513
  • Annotation
    This variant (3) differs in the 5' UTR and lacks an alternate in-frame exon compared to variant 1. The resulting isoform (b) has the same N- and C-termini but is shorter compared to isoform a.
  • siRNA

    GGAUUGAUUUGUCGGACUAtt

    GGAUUGCCGGUACAGCAAAtt

    GCGAUUCUAUGUGCGAGUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    CABIN1(XM_005261419) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens calcineurin binding protein 1 (CABIN1), transcript variant X6, mRNA.
  • Synonyms
  • ORF length
    6633
  • siRNA

    GGAUUGAUUUGUCGGACUAtt

    GGAUUGCCGGUACAGCAAAtt

    GCGAUUCUAUGUGCGAGUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    CABIN1(XM_005261415) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens calcineurin binding protein 1 (CABIN1), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    6768
  • siRNA

    GGAUUGAUUUGUCGGACUAtt

    GGAUUGCCGGUACAGCAAAtt

    GCGAUUCUAUGUGCGAGUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    CABIN1(XM_011530030) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens calcineurin binding protein 1 (CABIN1), transcript variant X14, mRNA.
  • Synonyms
  • ORF length
    4284
  • siRNA

    GGAUUGAUUUGUCGGACUAtt

    GGAUUGCCGGUACAGCAAAtt

    GCGAUUCUAUGUGCGAGUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    CABIN1(XM_017028681) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens calcineurin binding protein 1 (CABIN1), transcript variant X7, mRNA.
  • Synonyms
  • ORF length
    6618
  • siRNA

    GGAUUGAUUUGUCGGACUAtt

    GGAUUGCCGGUACAGCAAAtt

    GCGAUUCUAUGUGCGAGUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    CABIN1(XM_006724181) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens calcineurin binding protein 1 (CABIN1), transcript variant X9, mRNA.
  • Synonyms
  • ORF length
    6576
  • siRNA

    GGAUUGAUUUGUCGGACUAtt

    GGAUUGCCGGUACAGCAAAtt

    GCGAUUCUAUGUGCGAGUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    CABIN1(XM_006724179) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens calcineurin binding protein 1 (CABIN1), transcript variant X3, mRNA.
  • Synonyms
  • ORF length
    6681
  • siRNA

    GGAUUGAUUUGUCGGACUAtt

    GGAUUGCCGGUACAGCAAAtt

    GCGAUUCUAUGUGCGAGUAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"