NovoPro
Cart 2
  • C2CD5 Human  cDNA/ORF Clone

C2CD5 Human cDNA/ORF Clone

Cat.#: 767754-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 803.5 USD

Availability: 3-4 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    C2 calcium dependent domain containing 5
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    C2CD5
  • Gene Type
    protein coding
  • Also Known as
    CDP138; KIAA0528
  • Product Name
    C2CD5(XM_017020268) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens C2 calcium-dependent domain containing 5 (C2CD5), transcript variant X5, mRNA.
  • Synonyms
  • ORF length
    3348
  • siRNA

    GCUCGGAUGAAGUUACAGAtt

    GGAAAUUUCCGGAAUCGUUtt

    GCCUCAACCUGACUAAUCAtt

  • DataSheet:
  • FAQs:
  • Product Name
    C2CD5(XM_006719170) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens C2 calcium-dependent domain containing 5 (C2CD5), transcript variant X15, mRNA.
  • Synonyms
  • ORF length
    3054
  • siRNA

    GCUCGGAUGAAGUUACAGAtt

    GGAAAUUUCCGGAAUCGUUtt

    GCCUCAACCUGACUAAUCAtt

  • DataSheet:
  • FAQs:
  • Product Name
    C2CD5(XM_017020278) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens C2 calcium-dependent domain containing 5 (C2CD5), transcript variant X16, mRNA.
  • Synonyms
  • ORF length
    3042
  • siRNA

    GCUCGGAUGAAGUUACAGAtt

    GGAAAUUUCCGGAAUCGUUtt

    GCCUCAACCUGACUAAUCAtt

  • DataSheet:
  • FAQs:
  • Product Name
    C2CD5(XM_005253539) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens C2 calcium-dependent domain containing 5 (C2CD5), transcript variant X19, mRNA.
  • Synonyms
  • ORF length
    2022
  • siRNA

    GCUCGGAUGAAGUUACAGAtt

    GGAAAUUUCCGGAAUCGUUtt

    GCCUCAACCUGACUAAUCAtt

  • DataSheet:
  • FAQs:
  • Product Name
    C2CD5(NM_001286177) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens C2 calcium dependent domain containing 5 (C2CD5), transcript variant 5, mRNA.
  • Synonyms
  • ORF length
    3129
  • Annotation
    This variant (5) lacks an exon and contains an alternate exon, but maintains the reading frame, compared to variant 1. The encoded isoform (d) is shorter than isoform a.
  • siRNA

    GCUCGGAUGAAGUUACAGAtt

    GGAAAUUUCCGGAAUCGUUtt

    GCCUCAACCUGACUAAUCAtt

  • DataSheet:
  • FAQs:
  • Product Name
    C2CD5(XM_017020265) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens C2 calcium-dependent domain containing 5 (C2CD5), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    3456
  • siRNA

    GCUCGGAUGAAGUUACAGAtt

    GGAAAUUUCCGGAAUCGUUtt

    GCCUCAACCUGACUAAUCAtt

  • DataSheet:
  • FAQs:
  • Product Name
    C2CD5(XM_017020277) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens C2 calcium-dependent domain containing 5 (C2CD5), transcript variant X14, mRNA.
  • Synonyms
  • ORF length
    3078
  • siRNA

    GCUCGGAUGAAGUUACAGAtt

    GGAAAUUUCCGGAAUCGUUtt

    GCCUCAACCUGACUAAUCAtt

  • DataSheet:
  • FAQs:
  • Product Name
    C2CD5(NM_001286174) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens C2 calcium dependent domain containing 5 (C2CD5), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    3156
  • Annotation
    This variant (2) differs in the 5' UTR, compared to variant 1. Variants 1 and 2 encode the same isoform (a).
  • siRNA

    GCUCGGAUGAAGUUACAGAtt

    GGAAAUUUCCGGAAUCGUUtt

    GCCUCAACCUGACUAAUCAtt

  • DataSheet:
  • FAQs:
  • Product Name
    C2CD5(XM_005253538) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens C2 calcium-dependent domain containing 5 (C2CD5), transcript variant X17, mRNA.
  • Synonyms
  • ORF length
    2976
  • siRNA

    GCUCGGAUGAAGUUACAGAtt

    GGAAAUUUCCGGAAUCGUUtt

    GCCUCAACCUGACUAAUCAtt

  • DataSheet:
  • FAQs:
  • Product Name
    C2CD5(NM_001286175) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens C2 calcium dependent domain containing 5 (C2CD5), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    3165
  • Annotation
    This variant (3) lacks an exon, contains two alternate exons, and uses an alternate splice site, but maintains the reading frame, compared to variant 1. The encoded isoform (b) is longer than isoform a.
  • siRNA

    GCUCGGAUGAAGUUACAGAtt

    GGAAAUUUCCGGAAUCGUUtt

    GCCUCAACCUGACUAAUCAtt

  • DataSheet:
  • FAQs:
  • Product Name
    C2CD5(XM_017020273) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens C2 calcium-dependent domain containing 5 (C2CD5), transcript variant X10, mRNA.
  • Synonyms
  • ORF length
    3144
  • siRNA

    GCUCGGAUGAAGUUACAGAtt

    GGAAAUUUCCGGAAUCGUUtt

    GCCUCAACCUGACUAAUCAtt

  • DataSheet:
  • FAQs:
  • Product Name
    C2CD5(XM_017020272) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens C2 calcium-dependent domain containing 5 (C2CD5), transcript variant X9, mRNA.
  • Synonyms
  • ORF length
    3195
  • siRNA

    GCUCGGAUGAAGUUACAGAtt

    GGAAAUUUCCGGAAUCGUUtt

    GCCUCAACCUGACUAAUCAtt

  • DataSheet:
  • FAQs:
  • Product Name
    C2CD5(XM_017020264) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens C2 calcium-dependent domain containing 5 (C2CD5), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    3486
  • siRNA

    GCUCGGAUGAAGUUACAGAtt

    GGAAAUUUCCGGAAUCGUUtt

    GCCUCAACCUGACUAAUCAtt

  • DataSheet:
  • FAQs:
  • Product Name
    C2CD5(XM_017020276) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens C2 calcium-dependent domain containing 5 (C2CD5), transcript variant X13, mRNA.
  • Synonyms
  • ORF length
    3099
  • siRNA

    GCUCGGAUGAAGUUACAGAtt

    GGAAAUUUCCGGAAUCGUUtt

    GCCUCAACCUGACUAAUCAtt

  • DataSheet:
  • FAQs:
  • Product Name
    C2CD5(XM_017020270) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens C2 calcium-dependent domain containing 5 (C2CD5), transcript variant X7, mRNA.
  • Synonyms
  • ORF length
    3294
  • siRNA

    GCUCGGAUGAAGUUACAGAtt

    GGAAAUUUCCGGAAUCGUUtt

    GCCUCAACCUGACUAAUCAtt

  • DataSheet:
  • FAQs:
  • Product Name
    C2CD5(XM_017020274) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens C2 calcium-dependent domain containing 5 (C2CD5), transcript variant X11, mRNA.
  • Synonyms
  • ORF length
    3126
  • siRNA

    GCUCGGAUGAAGUUACAGAtt

    GGAAAUUUCCGGAAUCGUUtt

    GCCUCAACCUGACUAAUCAtt

  • DataSheet:
  • FAQs:
  • Product Name
    C2CD5(NM_014802) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens C2 calcium dependent domain containing 5 (C2CD5), transcript variant 6, mRNA.
  • Synonyms
  • ORF length
    3003
  • Annotation
    This variant (6) lacks two alternate exons, but maintains the reading frame, compared to variant 1. The encoded isoform (e) is shorter than isoform a.
  • siRNA

    GCUCGGAUGAAGUUACAGAtt

    GGAAAUUUCCGGAAUCGUUtt

    GCCUCAACCUGACUAAUCAtt

  • DataSheet:
  • FAQs:
  • Product Name
    C2CD5(XM_017020267) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens C2 calcium-dependent domain containing 5 (C2CD5), transcript variant X4, mRNA.
  • Synonyms
  • ORF length
    3414
  • siRNA

    GCUCGGAUGAAGUUACAGAtt

    GGAAAUUUCCGGAAUCGUUtt

    GCCUCAACCUGACUAAUCAtt

  • DataSheet:
  • FAQs:
  • Product Name
    C2CD5(XM_017020266) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens C2 calcium-dependent domain containing 5 (C2CD5), transcript variant X3, mRNA.
  • Synonyms
  • ORF length
    3435
  • siRNA

    GCUCGGAUGAAGUUACAGAtt

    GGAAAUUUCCGGAAUCGUUtt

    GCCUCAACCUGACUAAUCAtt

  • DataSheet:
  • FAQs:
  • Product Name
    C2CD5(XM_017020271) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens C2 calcium-dependent domain containing 5 (C2CD5), transcript variant X8, mRNA.
  • Synonyms
  • ORF length
    3267
  • siRNA

    GCUCGGAUGAAGUUACAGAtt

    GGAAAUUUCCGGAAUCGUUtt

    GCCUCAACCUGACUAAUCAtt

  • DataSheet:
  • FAQs:
  • Product Name
    C2CD5(NM_001286173) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens C2 calcium dependent domain containing 5 (C2CD5), transcript variant 4, mRNA.
  • Synonyms
  • ORF length
    3162
  • Annotation
    This variant (4) lacks an exon and contains two alternate exons, but maintains the reading frame, compared to variant 1. The encoded isoform (c) is longer than isoform a.
  • siRNA

    GCUCGGAUGAAGUUACAGAtt

    GGAAAUUUCCGGAAUCGUUtt

    GCCUCAACCUGACUAAUCAtt

  • DataSheet:
  • FAQs:
  • Product Name
    C2CD5(XM_017020269) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens C2 calcium-dependent domain containing 5 (C2CD5), transcript variant X6, mRNA.
  • Synonyms
  • ORF length
    3333
  • siRNA

    GCUCGGAUGAAGUUACAGAtt

    GGAAAUUUCCGGAAUCGUUtt

    GCCUCAACCUGACUAAUCAtt

  • DataSheet:
  • FAQs:
  • Product Name
    C2CD5(XM_017020275) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens C2 calcium-dependent domain containing 5 (C2CD5), transcript variant X12, mRNA.
  • Synonyms
  • ORF length
    3114
  • siRNA

    GCUCGGAUGAAGUUACAGAtt

    GGAAAUUUCCGGAAUCGUUtt

    GCCUCAACCUGACUAAUCAtt

  • DataSheet:
  • FAQs:
  • Product Name
    C2CD5(XM_017020279) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens C2 calcium-dependent domain containing 5 (C2CD5), transcript variant X18, mRNA.
  • Synonyms
  • ORF length
    2340
  • siRNA

    GCUCGGAUGAAGUUACAGAtt

    GGAAAUUUCCGGAAUCGUUtt

    GCCUCAACCUGACUAAUCAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pCR4-TOPO
  • primers
    M13 fwd: GTAAAACGACGGCCAGT
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    3956
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    None
  • Description
    TOPO Cloning vector with ampicillin resistance in bacteria.
  • Vector Name
    pEXP-Entry
  • primers
    T7: TAATACGACTCACTATAGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4919
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    Myc,FLAG
  • Description
    ORFs cloned in this vector will be expressed in mammalian cellsas a tagged protein with the C-terminal Myc-FLAG tags.
    Such clones are the best for detection and purification of the transgene using anti-Myc or anti-FLAG antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"