Cart 2
  • ANK3 Human  cDNA/ORF Clone

ANK3 Human cDNA/ORF Clone

Cat.#: 758405-1

  • Accession#:
  • Vector:
Optional Service:

Special Price Inquiry USD

Availability: Inquiry
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    ankyrin 3
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    ANK3
  • Gene Type
    protein coding
  • Also Known as
    MRT37; ANKYRIN-G
  • Product Name
    ANK3(XM_017016145) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens ankyrin 3, node of Ranvier (ankyrin G) (ANK3), transcript variant X41, mRNA.
  • Synonyms
  • ORF length
    5217
  • siRNA

    GAGUUAGGGAAAAAGCGUAtt

    CAUCACCACUAGCAGCAUAtt

    GCAUCCUUAGCUUUACGUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ANK3(XM_017016150) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens ankyrin 3, node of Ranvier (ankyrin G) (ANK3), transcript variant X46, mRNA.
  • Synonyms
  • ORF length
    13140
  • siRNA

    GAGUUAGGGAAAAAGCGUAtt

    CAUCACCACUAGCAGCAUAtt

    GCAUCCUUAGCUUUACGUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ANK3(XM_017016115) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens ankyrin 3, node of Ranvier (ankyrin G) (ANK3), transcript variant X6, mRNA.
  • Synonyms
  • ORF length
    13437
  • siRNA

    GAGUUAGGGAAAAAGCGUAtt

    CAUCACCACUAGCAGCAUAtt

    GCAUCCUUAGCUUUACGUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ANK3(XM_017016112) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens ankyrin 3, node of Ranvier (ankyrin G) (ANK3), transcript variant X3, mRNA.
  • Synonyms
  • ORF length
    13500
  • siRNA

    GAGUUAGGGAAAAAGCGUAtt

    CAUCACCACUAGCAGCAUAtt

    GCAUCCUUAGCUUUACGUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ANK3(NM_001204403) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens ankyrin 3 (ANK3), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    5586
  • Annotation
    This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region, initiates translation at an alternate start codon, and lacks an alternate in-frame exon compared to variant 1. The encoded protein (isoform 3) has a distinct N-terminus and is considerably shorter than isoform 1.
  • siRNA

    GAGUUAGGGAAAAAGCGUAtt

    CAUCACCACUAGCAGCAUAtt

    GCAUCCUUAGCUUUACGUAtt

    CGGCCGAACUUUUUCCCAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ANK3(XM_006717802) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens ankyrin 3, node of Ranvier (ankyrin G) (ANK3), transcript variant X22, mRNA.
  • Synonyms
  • ORF length
    5697
  • siRNA

    GAGUUAGGGAAAAAGCGUAtt

    CAUCACCACUAGCAGCAUAtt

    GCAUCCUUAGCUUUACGUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ANK3(XM_017016120) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens ankyrin 3, node of Ranvier (ankyrin G) (ANK3), transcript variant X11, mRNA.
  • Synonyms
  • ORF length
    11862
  • siRNA

    GAGUUAGGGAAAAAGCGUAtt

    CAUCACCACUAGCAGCAUAtt

    GCAUCCUUAGCUUUACGUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ANK3(NM_001320874) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens ankyrin 3 (ANK3), transcript variant 5, mRNA.
  • Synonyms
  • ORF length
    5604
  • Annotation
    This variant (5) contains one and lacks two alternate in-frame exons in its 3' coding region compared to variant 1. The encoded isoform (5) is shorter than isoform 1.
  • siRNA

    GAGUUAGGGAAAAAGCGUAtt

    CAUCACCACUAGCAGCAUAtt

    GCAUCCUUAGCUUUACGUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ANK3(XM_017016144) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens ankyrin 3, node of Ranvier (ankyrin G) (ANK3), transcript variant X40, mRNA.
  • Synonyms
  • ORF length
    5226
  • siRNA

    GAGUUAGGGAAAAAGCGUAtt

    CAUCACCACUAGCAGCAUAtt

    GCAUCCUUAGCUUUACGUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ANK3(XM_017016110) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens ankyrin 3, node of Ranvier (ankyrin G) (ANK3), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    13515
  • siRNA

    GAGUUAGGGAAAAAGCGUAtt

    CAUCACCACUAGCAGCAUAtt

    GCAUCCUUAGCUUUACGUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ANK3(XM_017016116) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens ankyrin 3, node of Ranvier (ankyrin G) (ANK3), transcript variant X7, mRNA.
  • Synonyms
  • ORF length
    13206
  • siRNA

    GAGUUAGGGAAAAAGCGUAtt

    CAUCACCACUAGCAGCAUAtt

    GCAUCCUUAGCUUUACGUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ANK3(XM_017016121) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens ankyrin 3, node of Ranvier (ankyrin G) (ANK3), transcript variant X12, mRNA.
  • Synonyms
  • ORF length
    11838
  • siRNA

    GAGUUAGGGAAAAAGCGUAtt

    CAUCACCACUAGCAGCAUAtt

    GCAUCCUUAGCUUUACGUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ANK3(XM_017016113) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens ankyrin 3, node of Ranvier (ankyrin G) (ANK3), transcript variant X4, mRNA.
  • Synonyms
  • ORF length
    13488
  • siRNA

    GAGUUAGGGAAAAAGCGUAtt

    CAUCACCACUAGCAGCAUAtt

    GCAUCCUUAGCUUUACGUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ANK3(XM_017016139) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens ankyrin 3, node of Ranvier (ankyrin G) (ANK3), transcript variant X35, mRNA.
  • Synonyms
  • ORF length
    5295
  • siRNA

    GAGUUAGGGAAAAAGCGUAtt

    CAUCACCACUAGCAGCAUAtt

    GCAUCCUUAGCUUUACGUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ANK3(XM_017016129) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens ankyrin 3, node of Ranvier (ankyrin G) (ANK3), transcript variant X24, mRNA.
  • Synonyms
  • ORF length
    5667
  • siRNA

    GAGUUAGGGAAAAAGCGUAtt

    CAUCACCACUAGCAGCAUAtt

    GCAUCCUUAGCUUUACGUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ANK3(XM_017016114) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens ankyrin 3, node of Ranvier (ankyrin G) (ANK3), transcript variant X5, mRNA.
  • Synonyms
  • ORF length
    13464
  • siRNA

    GAGUUAGGGAAAAAGCGUAtt

    CAUCACCACUAGCAGCAUAtt

    GCAUCCUUAGCUUUACGUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ANK3(XM_006717796) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens ankyrin 3, node of Ranvier (ankyrin G) (ANK3), transcript variant X14, mRNA.
  • Synonyms
  • ORF length
    8277
  • siRNA

    GAGUUAGGGAAAAAGCGUAtt

    CAUCACCACUAGCAGCAUAtt

    GCAUCCUUAGCUUUACGUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ANK3(XM_017016111) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens ankyrin 3, node of Ranvier (ankyrin G) (ANK3), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    13503
  • siRNA

    GAGUUAGGGAAAAAGCGUAtt

    CAUCACCACUAGCAGCAUAtt

    GCAUCCUUAGCUUUACGUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ANK3(XM_017016148) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens ankyrin 3, node of Ranvier (ankyrin G) (ANK3), transcript variant X44, mRNA.
  • Synonyms
  • ORF length
    5178
  • siRNA

    GAGUUAGGGAAAAAGCGUAtt

    CAUCACCACUAGCAGCAUAtt

    GCAUCCUUAGCUUUACGUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ANK3(XM_017016128) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens ankyrin 3, node of Ranvier (ankyrin G) (ANK3), transcript variant X23, mRNA.
  • Synonyms
  • ORF length
    5670
  • siRNA

    GAGUUAGGGAAAAAGCGUAtt

    CAUCACCACUAGCAGCAUAtt

    GCAUCCUUAGCUUUACGUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ANK3(XM_017016137) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens ankyrin 3, node of Ranvier (ankyrin G) (ANK3), transcript variant X33, mRNA.
  • Synonyms
  • ORF length
    5361
  • siRNA

    GAGUUAGGGAAAAAGCGUAtt

    CAUCACCACUAGCAGCAUAtt

    GCAUCCUUAGCUUUACGUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ANK3(XM_017016140) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens ankyrin 3, node of Ranvier (ankyrin G) (ANK3), transcript variant X36, mRNA.
  • Synonyms
  • ORF length
    5292
  • siRNA

    GAGUUAGGGAAAAAGCGUAtt

    CAUCACCACUAGCAGCAUAtt

    GCAUCCUUAGCUUUACGUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ANK3(XM_017016122) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens ankyrin 3, node of Ranvier (ankyrin G) (ANK3), transcript variant X15, mRNA.
  • Synonyms
  • ORF length
    8187
  • siRNA

    GAGUUAGGGAAAAAGCGUAtt

    CAUCACCACUAGCAGCAUAtt

    GCAUCCUUAGCUUUACGUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ANK3(XM_005269715) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens ankyrin 3, node of Ranvier (ankyrin G) (ANK3), transcript variant X25, mRNA.
  • Synonyms
  • ORF length
    5658
  • siRNA

    GAGUUAGGGAAAAAGCGUAtt

    CAUCACCACUAGCAGCAUAtt

    GCAUCCUUAGCUUUACGUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ANK3(NM_001204404) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens ankyrin 3 (ANK3), transcript variant 4, mRNA.
  • Synonyms
  • ORF length
    5607
  • Annotation
    This variant (4) differs in the 5' UTR, lacks a portion of the 5' coding region, initiates translation at an alternate start codon, and lacks an alternate in-frame exon compared to variant 1. The encoded protein (isoform 4) has a distinct N-terminus and is considerably shorter than isoform 1.
  • siRNA

    GAGUUAGGGAAAAAGCGUAtt

    CAUCACCACUAGCAGCAUAtt

    GCAUCCUUAGCUUUACGUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ANK3(XM_011539709) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens ankyrin 3, node of Ranvier (ankyrin G) (ANK3), transcript variant X16, mRNA.
  • Synonyms
  • ORF length
    7971
  • siRNA

    GAGUUAGGGAAAAAGCGUAtt

    CAUCACCACUAGCAGCAUAtt

    GCAUCCUUAGCUUUACGUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ANK3(XM_017016117) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens ankyrin 3, node of Ranvier (ankyrin G) (ANK3), transcript variant X8, mRNA.
  • Synonyms
  • ORF length
    13203
  • siRNA

    GAGUUAGGGAAAAAGCGUAtt

    CAUCACCACUAGCAGCAUAtt

    GCAUCCUUAGCUUUACGUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ANK3(XM_017016138) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens ankyrin 3, node of Ranvier (ankyrin G) (ANK3), transcript variant X34, mRNA.
  • Synonyms
  • ORF length
    5358
  • siRNA

    GAGUUAGGGAAAAAGCGUAtt

    CAUCACCACUAGCAGCAUAtt

    GCAUCCUUAGCUUUACGUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ANK3(XM_017016125) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens ankyrin 3, node of Ranvier (ankyrin G) (ANK3), transcript variant X19, mRNA.
  • Synonyms
  • ORF length
    7941
  • siRNA

    GAGUUAGGGAAAAAGCGUAtt

    CAUCACCACUAGCAGCAUAtt

    GCAUCCUUAGCUUUACGUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ANK3(XM_017016127) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens ankyrin 3, node of Ranvier (ankyrin G) (ANK3), transcript variant X21, mRNA.
  • Synonyms
  • ORF length
    7812
  • siRNA

    GAGUUAGGGAAAAAGCGUAtt

    CAUCACCACUAGCAGCAUAtt

    GCAUCCUUAGCUUUACGUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ANK3(XM_017016133) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens ankyrin 3, node of Ranvier (ankyrin G) (ANK3), transcript variant X29, mRNA.
  • Synonyms
  • ORF length
    5553
  • siRNA

    GAGUUAGGGAAAAAGCGUAtt

    CAUCACCACUAGCAGCAUAtt

    GCAUCCUUAGCUUUACGUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ANK3(XM_017016126) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens ankyrin 3, node of Ranvier (ankyrin G) (ANK3), transcript variant X20, mRNA.
  • Synonyms
  • ORF length
    7839
  • siRNA

    GAGUUAGGGAAAAAGCGUAtt

    CAUCACCACUAGCAGCAUAtt

    GCAUCCUUAGCUUUACGUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ANK3(XM_017016123) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens ankyrin 3, node of Ranvier (ankyrin G) (ANK3), transcript variant X17, mRNA.
  • Synonyms
  • ORF length
    7968
  • siRNA

    GAGUUAGGGAAAAAGCGUAtt

    CAUCACCACUAGCAGCAUAtt

    GCAUCCUUAGCUUUACGUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ANK3(XM_017016143) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens ankyrin 3, node of Ranvier (ankyrin G) (ANK3), transcript variant X39, mRNA.
  • Synonyms
  • ORF length
    5229
  • siRNA

    GAGUUAGGGAAAAAGCGUAtt

    CAUCACCACUAGCAGCAUAtt

    GCAUCCUUAGCUUUACGUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ANK3(XM_017016149) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens ankyrin 3, node of Ranvier (ankyrin G) (ANK3), transcript variant X45, mRNA.
  • Synonyms
  • ORF length
    5163
  • siRNA

    GAGUUAGGGAAAAAGCGUAtt

    CAUCACCACUAGCAGCAUAtt

    GCAUCCUUAGCUUUACGUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ANK3(XM_017016118) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens ankyrin 3, node of Ranvier (ankyrin G) (ANK3), transcript variant X9, mRNA.
  • Synonyms
  • ORF length
    12174
  • siRNA

    GAGUUAGGGAAAAAGCGUAtt

    CAUCACCACUAGCAGCAUAtt

    GCAUCCUUAGCUUUACGUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ANK3(XM_017016142) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens ankyrin 3, node of Ranvier (ankyrin G) (ANK3), transcript variant X38, mRNA.
  • Synonyms
  • ORF length
    5244
  • siRNA

    GAGUUAGGGAAAAAGCGUAtt

    CAUCACCACUAGCAGCAUAtt

    GCAUCCUUAGCUUUACGUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ANK3(XM_017016124) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens ankyrin 3, node of Ranvier (ankyrin G) (ANK3), transcript variant X18, mRNA.
  • Synonyms
  • ORF length
    7944
  • siRNA

    GAGUUAGGGAAAAAGCGUAtt

    CAUCACCACUAGCAGCAUAtt

    GCAUCCUUAGCUUUACGUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ANK3(XM_017016141) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens ankyrin 3, node of Ranvier (ankyrin G) (ANK3), transcript variant X37, mRNA.
  • Synonyms
  • ORF length
    5256
  • siRNA

    GAGUUAGGGAAAAAGCGUAtt

    CAUCACCACUAGCAGCAUAtt

    GCAUCCUUAGCUUUACGUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ANK3(XM_017016119) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens ankyrin 3, node of Ranvier (ankyrin G) (ANK3), transcript variant X10, mRNA.
  • Synonyms
  • ORF length
    11865
  • siRNA

    GAGUUAGGGAAAAAGCGUAtt

    CAUCACCACUAGCAGCAUAtt

    GCAUCCUUAGCUUUACGUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ANK3(XM_017016136) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens ankyrin 3, node of Ranvier (ankyrin G) (ANK3), transcript variant X32, mRNA.
  • Synonyms
  • ORF length
    5388
  • siRNA

    GAGUUAGGGAAAAAGCGUAtt

    CAUCACCACUAGCAGCAUAtt

    GCAUCCUUAGCUUUACGUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ANK3(XM_017016146) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens ankyrin 3, node of Ranvier (ankyrin G) (ANK3), transcript variant X42, mRNA.
  • Synonyms
  • ORF length
    5214
  • siRNA

    GAGUUAGGGAAAAAGCGUAtt

    CAUCACCACUAGCAGCAUAtt

    GCAUCCUUAGCUUUACGUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ANK3(XM_011539708) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens ankyrin 3, node of Ranvier (ankyrin G) (ANK3), transcript variant X13, mRNA.
  • Synonyms
  • ORF length
    8280
  • siRNA

    GAGUUAGGGAAAAAGCGUAtt

    CAUCACCACUAGCAGCAUAtt

    GCAUCCUUAGCUUUACGUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ANK3(NM_020987) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens ankyrin 3 (ANK3), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    13134
  • Annotation
    This variant (1) represents the longest transcript and encodes the longest isoform (1).
  • siRNA

    GAGUUAGGGAAAAAGCGUAtt

    CAUCACCACUAGCAGCAUAtt

    GCAUCCUUAGCUUUACGUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ANK3(XM_017016134) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens ankyrin 3, node of Ranvier (ankyrin G) (ANK3), transcript variant X30, mRNA.
  • Synonyms
  • ORF length
    5538
  • siRNA

    GAGUUAGGGAAAAAGCGUAtt

    CAUCACCACUAGCAGCAUAtt

    GCAUCCUUAGCUUUACGUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ANK3(XM_017016130) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens ankyrin 3, node of Ranvier (ankyrin G) (ANK3), transcript variant X26, mRNA.
  • Synonyms
  • ORF length
    5601
  • siRNA

    GAGUUAGGGAAAAAGCGUAtt

    CAUCACCACUAGCAGCAUAtt

    GCAUCCUUAGCUUUACGUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ANK3(XM_017016131) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens ankyrin 3, node of Ranvier (ankyrin G) (ANK3), transcript variant X27, mRNA.
  • Synonyms
  • ORF length
    5589
  • siRNA

    GAGUUAGGGAAAAAGCGUAtt

    CAUCACCACUAGCAGCAUAtt

    GCAUCCUUAGCUUUACGUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ANK3(NM_001149) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens ankyrin 3 (ANK3), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    3006
  • Annotation
    This variant (2) has multiple differences in the 5' UTR and coding sequence compared to variant 1, resulting in an isoform (2) which is considerably shorter and different compared to isoform 1.
  • siRNA

    GAGUUAGGGAAAAAGCGUAtt

    CAUCACCACUAGCAGCAUAtt

    GCAUCCUUAGCUUUACGUAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"