NovoPro
Cart 2
  • HSPB8 Dog  cDNA/ORF Clones

HSPB8 Dog cDNA/ORF Clones

Cat.#: 734341-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 122.6 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    heat shock protein family B (small) member 8
  • Organism
    Dog
  • Entrez Gene ID
  • Gene Symbol
    HSPB8
  • Gene Type
    protein coding
  • Encoded Protein Alias
    H11 kinase; heat shock 27kDa protein 8; protein kinase H11
  • Product Name
    HSPB8(NM_001003029) Dog cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Canis lupus familiaris heat shock protein family B (small) member 8 (HSPB8), mRNA.
  • Synonyms
  • ORF length
    591
  • DataSheet:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"