NovoPro
Cart 2
  • HNRNPA0 Ferret  cDNA/ORF Clones

HNRNPA0 Ferret cDNA/ORF Clones

Cat.#: 700146-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 158.9 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    heterogeneous nuclear ribonucleoprotein A0
  • Organism
    Ferret
  • Entrez Gene ID
  • Gene Symbol
    HNRNPA0
  • Gene Type
    protein coding
  • Encoded Protein Alias
    heterogeneous nuclear ribonucleoprotein A0
  • Product Name
    HNRNPA0(XM_004744903) Ferret cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mustela putorius furo heterogeneous nuclear ribonucleoprotein A0 (HNRNPA0), mRNA.
  • Synonyms
  • ORF length
    927
  • DataSheet:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"