NovoPro
Cart 2
  • GNA13 Human  cDNA/ORF Clones

GNA13 Human cDNA/ORF Clones

Cat.#: 710122-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 159.2 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    G protein subunit alpha 13
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    GNA13
  • Gene Type
    protein coding
  • Also Known as
    G13
  • Encoded Protein Alias
    guanine nucleotide-binding protein subunit alpha-13; G-protein subunit alpha-13; g alpha-13
  • Product Name
    GNA13(NM_001282425) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens G protein subunit alpha 13 (GNA13), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    849
  • Annotation
    This variant (2) uses an alternate 5' terminal exon which results in the use of a downstream AUG compared to variant 1. The encoded isoform (2) has a shorter N-terminus compared to isoform 1.
  • siRNA

    CAAAGACUAUUUCCUAGAAtt

    CAAGGGUUUUCUUACAAUAtt

  • DataSheet:
  • Product Name
    GNA13(XM_011524202) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens G protein subunit alpha 13 (GNA13), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    612
  • siRNA

    CAAGGGUUUUCUUACAAUAtt

  • DataSheet:
  • Product Name
    GNA13(NM_006572) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens G protein subunit alpha 13 (GNA13), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    1134
  • Annotation
    This variant (1) represents the longer transcript and encodes the longer isoform (1).
  • siRNA

    CAAAGACUAUUUCCUAGAAtt

    CAAGGGUUUUCUUACAAUAtt

  • DataSheet:
  • DataSheet:
  • DataSheet:
  • Vector Name
    pCMV-SPORT6
  • primers
    T7: TAATACGACTCACTATAGGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4396
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    Vector for cloning and transient mammalian cell expression of cDNAs.
  • Vector Name
    pEXP-untagged
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    6223
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Hygromycin
  • Protein Tag
    None
  • Description
    All of the pEXP vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
    • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
    • Hygromycin resistance gene for selection of mammalian cell lines.
    • A Kozak consensus sequence to enhance mammalian expression.
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"