NovoPro
Cart 2
  • GLS Human  cDNA/ORF Clones

GLS Human cDNA/ORF Clones

Cat.#: 713748-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 336.9 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    glutaminase
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    GLS
  • Gene Type
    protein coding
  • Also Known as
    GAC; GAM; KGA; GLS1; AAD20
  • Encoded Protein Alias
    glutaminase kidney isoform, mitochondrial; K-glutaminase; L-glutamine amidohydrolase; glutaminase C; glutaminase, phosphate-activated
  • Product Name
    GLS(NM_001256310) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens glutaminase (GLS), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    1797
  • Annotation
    This variant (2) lacks several exons and includes an alternate 3' terminal exon, compared to variant 1. It encodes isoform 2 which is shorter and has a distinct C-terminus, compared to isoform 1.
  • siRNA

    UUAACUAUGUGGUCAGAUAtt

    UGUUAAGAAUGAGCAGAAAtt

    GGACUAUGAAAGUCUCCAAtt

    GUGCAUUUGUUGGUCUUUAtt

    GAACUUGCUUUAAAAGAGAtt

    CUGAAUAUGUGCAUCGAUAtt

    GAUUUGCUGUUCUAUACAAtt

  • DataSheet:
  • Product Name
    GLS(XM_017003829) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens glutaminase (GLS), transcript variant X4, mRNA.
  • Synonyms
  • ORF length
    1050
  • siRNA

    CUGAAUAUGUGCAUCGAUAtt

    GAUUUGCUGUUCUAUACAAtt

  • DataSheet:
  • Product Name
    GLS(NM_014905) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens glutaminase (GLS), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    2010
  • Annotation
    This variant (1) represents the longer transcript and encodes the longer isoform (1).
  • siRNA

    CUGAAUAUGUGCAUCGAUAtt

    GGACAGGUGGAAUAACACUtt

    GAUUUGCUGUUCUAUACAAtt

  • DataSheet:
  • DataSheet:
  • Product Name
    GLS(XM_005246467) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens glutaminase (GLS), transcript variant X3, mRNA.
  • Synonyms
  • ORF length
    1680
  • siRNA

    GUAUGUUGCUUGAACAACUtt

    UUAACUAUGUGGUCAGAUAtt

    UGUUAAGAAUGAGCAGAAAtt

    GGACUAUGAAAGUCUCCAAtt

    GUGCAUUUGUUGGUCUUUAtt

    GAACUUGCUUUAAAAGAGAtt

    CUGAAUAUGUGCAUCGAUAtt

    GAUUUGCUGUUCUAUACAAtt

  • DataSheet:
  • Product Name
    GLS(XM_006712435) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens glutaminase (GLS), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    1986
  • siRNA

    CUGAAUAUGUGCAUCGAUAtt

    GAUUUGCUGUUCUAUACAAtt

  • DataSheet:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"