NovoPro
Cart 2
  • GRIN1 Human  cDNA/ORF Clones

GRIN1 Human cDNA/ORF Clones

Cat.#: 713674-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 463.8 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    glutamate ionotropic receptor NMDA type subunit 1
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    GRIN1
  • Gene Type
    protein coding
  • Also Known as
    NR1; MRD8; GluN1; NMDA1; NMD-R1; NMDAR1
  • Encoded Protein Alias
    glutamate receptor ionotropic, NMDA 1; N-methyl-D-aspartate receptor channel, subunit zeta-1; N-methyl-D-aspartate receptor subunit NR1; glutamate [NMDA] receptor subunit zeta 1; glutamate [NMDA] receptor subunit zeta-1
  • Product Name
    GRIN1(NM_021569) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens glutamate ionotropic receptor NMDA type subunit 1 (GRIN1), transcript variant GluN1-2a, mRNA.
  • Synonyms
  • ORF length
    2706
  • Annotation
    This variant (GluN1-2a, also known as NR1-2) lacks an alternate in-frame exon in the 3' coding region, compared to variant GluN1-1a, resulting in a shorter protein (isoform GluN1-2a, also known as isoform NR1-2), compared to isoform GluN1-1a.
  • siRNA

    GCACCCACGUCAUCCCUAAtt

    GCAUGUCCAUCUACUCGGAtt

    GCACGGACCAUGAACUUCAtt

  • DataSheet:
  • Product Name
    GRIN1(NM_007327) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens glutamate ionotropic receptor NMDA type subunit 1 (GRIN1), transcript variant GluN1-1a, mRNA.
  • Synonyms
  • ORF length
    2817
  • Annotation
    This variant (GluN1-1a, also known as NR1-3) represents the longest transcript and encodes protein isoform GluN1-1a (also known as isoform NR1-3).
  • siRNA

    GCACCCACGUCAUCCCUAAtt

    GCAUGUCCAUCUACUCGGAtt

    GCACGGACCAUGAACUUCAtt

  • DataSheet:
  • Product Name
    GRIN1(XM_005266072) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens glutamate ionotropic receptor NMDA type subunit 1 (GRIN1), transcript variant X3, mRNA.
  • Synonyms
  • ORF length
    2769
  • siRNA

    GCACCCACGUCAUCCCUAAtt

    GCAUGUCCAUCUACUCGGAtt

    GCACGGACCAUGAACUUCAtt

  • DataSheet:
  • Product Name
    GRIN1(XM_005266071) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens glutamate ionotropic receptor NMDA type subunit 1 (GRIN1), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    2769
  • siRNA

    GCACCCACGUCAUCCCUAAtt

    GCAUGUCCAUCUACUCGGAtt

    GCACGGACCAUGAACUUCAtt

  • DataSheet:
  • Product Name
    GRIN1(XM_011518583) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens glutamate ionotropic receptor NMDA type subunit 1 (GRIN1), transcript variant X4, mRNA.
  • Synonyms
  • ORF length
    2679
  • siRNA

    GCACCCACGUCAUCCCUAAtt

    GCAUGUCCAUCUACUCGGAtt

    GCACGGACCAUGAACUUCAtt

  • DataSheet:
  • Product Name
    GRIN1(NM_000832) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens glutamate ionotropic receptor NMDA type subunit 1 (GRIN1), transcript variant GluN1-4a, mRNA.
  • Synonyms
  • ORF length
    2658
  • Annotation
    This variant (GluN1-4a, also known as NR1-1) lacks an alternate in-frame exon and uses an alternate splice site in the 3' coding region, compared to variant GluN1-1a. The resulting protein (isoform GluN1-4a, also known as isoform NR1-1) is shorter and has a different C-terminus, compared to isoform GluN1-1a.
  • siRNA

    GCACCCACGUCAUCCCUAAtt

    GCAUGUCCAUCUACUCGGAtt

    GCACGGACCAUGAACUUCAtt

  • DataSheet:
  • Product Name
    GRIN1(XM_005266073) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens glutamate ionotropic receptor NMDA type subunit 1 (GRIN1), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    2880
  • siRNA

    GCACCCACGUCAUCCCUAAtt

    GCAUGUCCAUCUACUCGGAtt

    GCACGGACCAUGAACUUCAtt

  • DataSheet:
  • Product Name
    GRIN1(NM_001185090) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens glutamate ionotropic receptor NMDA type subunit 1 (GRIN1), transcript variant GluN1-3b, mRNA.
  • Synonyms
  • ORF length
    2832
  • Annotation
    This variant (GluN1-3b, also known as NR1-4) contains an alternate coding segment and uses a different splice site in the 3' coding region, compared to variant GluN1-1a. The resulting protein (isoform GluN1-3b, also known as isoform NR1-4) is longer and has a distinct C-terminus when it is compared to isoform GluN1-1a. This variant has also been named isoform 4b or NMDAR1-4b.
  • siRNA

    GCACCCACGUCAUCCCUAAtt

    GCAUGUCCAUCUACUCGGAtt

    GCACGGACCAUGAACUUCAtt

  • DataSheet:
  • Product Name
    GRIN1(NM_001185091) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens glutamate ionotropic receptor NMDA type subunit 1 (GRIN1), transcript variant GluN1-5b, mRNA.
  • Synonyms
  • ORF length
    2721
  • Annotation
    This variant (GluN1-5b, also known as 5) contains an alternate coding segment, lacks a different alternate coding segment, and uses a different splice site in the 3' coding region, compared to variant GluN1-1a. The resulting protein (isoform GluN1-5b, also known as isoform 5) is shorter and has a distinct C-terminus when it is compared to isoform GluN1-1a. This variant has also been named isoform 3b or NMDAR1-3b.
  • siRNA

    GCACCCACGUCAUCCCUAAtt

    GCAUGUCCAUCUACUCGGAtt

    GCACGGACCAUGAACUUCAtt

  • DataSheet:
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"