NovoPro
Cart 2
  • GLI1 Human  cDNA/ORF Clones

GLI1 Human cDNA/ORF Clones

Cat.#: 713837-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 767.5 USD

Availability: 3-4 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    GLI family zinc finger 1
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    GLI1
  • Gene Type
    protein coding
  • Also Known as
    GLI
  • Encoded Protein Alias
    zinc finger protein GLI1; GLI-Kruppel family member GLI1; glioma-associated oncogene 1; glioma-associated oncogene homolog 1 (zinc finger protein); oncogene GLI
  • Product Name
    GLI1(NM_001167609) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens GLI family zinc finger 1 (GLI1), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    3198
  • Annotation
    This variant (3) lacks an in-frame segment in the 5' coding region, compared to variant 1, resulting in a shorter protein isoform (3), also known as tGLI1. This variant reflects the transcript and protein described by Lo (PubMed ID 19706761).
  • siRNA

    GAUCCUAGCUCGCUGCGAAtt

    CCAACUUGCCCAAUCACAAtt

    AGACAGUGCAUGGUCCUGAtt

  • DataSheet:
  • Product Name
    GLI1(NM_005269) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens GLI family zinc finger 1 (GLI1), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    3321
  • Annotation
    This variant (1) encodes the full length protein (isoform 1).
  • siRNA

    GAUCCUAGCUCGCUGCGAAtt

    CCAACUUGCCCAAUCACAAtt

    AGACAGUGCAUGGUCCUGAtt

  • DataSheet:
  • DataSheet:
  • DataSheet:
  • Product Name
    GLI1(NM_001160045) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens GLI family zinc finger 1 (GLI1), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    2937
  • Annotation
    This variant (1) omits the first two coding exons, compared to variant 1, resulting in transcription initiation from an internal AUG site and a N-terminally truncated protein isoform (2), also know as GLI1DeltaN. This variant reflects the transcript and protein described by Shimokawa (PubMed ID 18378682).
  • siRNA

    GAUCCUAGCUCGCUGCGAAtt

    CCAACUUGCCCAAUCACAAtt

    AGACAGUGCAUGGUCCUGAtt

  • DataSheet:
  • Product Name
    GLI1(XM_011538190) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens GLI family zinc finger 1 (GLI1), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    3090
  • siRNA

    CCAACUUGCCCAAUCACAAtt

  • DataSheet:
  • Vector Name
    pEXP-Entry
  • primers
    T7: TAATACGACTCACTATAGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4919
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    Myc,FLAG
  • Description
    ORFs cloned in this vector will be expressed in mammalian cellsas a tagged protein with the C-terminal Myc-FLAG tags.
    Such clones are the best for detection and purification of the transgene using anti-Myc or anti-FLAG antibodies.
  • Vector Name
    pOTB7
  • primers
    M13 fwd: GTAAAACGACGGCCAGT
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    1815
  • Vector Type
    Cloning Vector
  • Promoter
    -
  • Antibiotic Resistance
    Chloramphenicol
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    Gateway® or compatible clone with M13 forward and M13 reverse primers. Chloramphenicol resistance in bacteria.
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.
  • Antibodies
  • Recombinant Proteins
  • cDNA Clones

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"