NovoPro
Cart 2
  • GSN Human  cDNA/ORF Clones

GSN Human cDNA/ORF Clones

Cat.#: 713750-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 382.1 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    gelsolin
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    GSN
  • Gene Type
    protein coding
  • Also Known as
    ADF; AGEL
  • Encoded Protein Alias
    gelsolin; actin-depolymerizing factor; brevin
  • Product Name
    GSN(XM_017014644) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens gelsolin (GSN), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    2343
  • siRNA

    GGAUGAUGAUUACUGGUCUtt

    GGGUUGGAAAGGAUUCUCAtt

    ACAGCUACAUCAUUCUGUAtt

  • DataSheet:
  • Product Name
    GSN(NM_001127663) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens gelsolin (GSN), transcript variant 4, mRNA.
  • Synonyms
  • ORF length
    2304
  • Annotation
    This variant (4) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (f) has a shorter and distinct N-terminus compared to isoform a.
  • siRNA

    GGAUGAUGAUUACUGGUCUtt

    GGGUUGGAAAGGAUUCUCAtt

    ACAGCUACAUCAUUCUGUAtt

  • DataSheet:
  • Product Name
    GSN(NM_001258030) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens gelsolin (GSN), transcript variant 10, mRNA.
  • Synonyms
  • ORF length
    2220
  • Annotation
    This variant (10) uses an alternate first exon compared to that of variant 1. The resulting isoform (e) has a shorter and distinct N-terminus compared to isoform a.
  • siRNA

    GGAUGAUGAUUACUGGUCUtt

    GGGUUGGAAAGGAUUCUCAtt

    ACAGCUACAUCAUUCUGUAtt

  • DataSheet:
  • Product Name
    GSN(NM_001258029) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens gelsolin (GSN), transcript variant 9, mRNA.
  • Synonyms
  • ORF length
    2247
  • Annotation
    This variant (9) uses an alternate first exon compared to that of variant 1. The resulting isoform (d) has a shorter and distinct N-terminus compared to isoform a.
  • siRNA

    GGAUGAUGAUUACUGGUCUtt

    GGGUUGGAAAGGAUUCUCAtt

    ACAGCUACAUCAUUCUGUAtt

  • DataSheet:
  • Product Name
    GSN(XM_011518594) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens gelsolin (GSN), transcript variant X22, mRNA.
  • Synonyms
  • ORF length
    1722
  • siRNA

    GGAUGAUGAUUACUGGUCUtt

    GGGUUGGAAAGGAUUCUCAtt

    ACAGCUACAUCAUUCUGUAtt

  • DataSheet:
  • Product Name
    GSN(XM_011518585) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens gelsolin (GSN), transcript variant X4, mRNA.
  • Synonyms
  • ORF length
    2286
  • siRNA

    GGAUGAUGAUUACUGGUCUtt

    GGGUUGGAAAGGAUUCUCAtt

    ACAGCUACAUCAUUCUGUAtt

  • DataSheet:
  • Product Name
    GSN(NM_198252) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens gelsolin (GSN), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    2196
  • Annotation
    This variant (3) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (b) has a shorter N-terminus compared to isoform a. Variants 2, 3, 5, and 6 all encode isoform b.
  • siRNA

    GGAUGAUGAUUACUGGUCUtt

    GGGUUGGAAAGGAUUCUCAtt

    ACAGCUACAUCAUUCUGUAtt

  • DataSheet:
  • Product Name
    GSN(NM_000177) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens gelsolin (GSN), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    2349
  • Annotation
    This variant (1) represents the longest isoform (a).
  • siRNA

    GGAUGAUGAUUACUGGUCUtt

    GGGUUGGAAAGGAUUCUCAtt

    ACAGCUACAUCAUUCUGUAtt

  • DataSheet:
  • Product Name
    GSN(XM_017014645) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens gelsolin (GSN), transcript variant X5, mRNA.
  • Synonyms
  • ORF length
    2259
  • siRNA

    GGAUGAUGAUUACUGGUCUtt

    GGGUUGGAAAGGAUUCUCAtt

    ACAGCUACAUCAUUCUGUAtt

  • DataSheet:
  • Vector Name
    pOTB7
  • primers
    M13 fwd: GTAAAACGACGGCCAGT
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    1815
  • Vector Type
    Cloning Vector
  • Promoter
    -
  • Antibiotic Resistance
    Chloramphenicol
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    Gateway® or compatible clone with M13 forward and M13 reverse primers. Chloramphenicol resistance in bacteria.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"