NovoPro
Cart 2
  • Fyn Mouse  cDNA/ORF Clones

Fyn Mouse cDNA/ORF Clones

Cat.#: 709921-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 281.2 USD

Availability: In Stock
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    Fyn proto-oncogene
  • Organism
    Mouse
  • Entrez Gene ID
  • Gene Symbol
    Fyn
  • Gene Type
    protein coding
  • Also Known as
    AI448320; AW552119
  • Encoded Protein Alias
    tyrosine-protein kinase Fyn; Src Kinase p59; p59-Fyn; proto-oncogene c-Fyn; proto-oncogene tyrosine-protein kinase Fyn
  • Product Name
    Fyn(NM_008054) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus Fyn proto-oncogene (Fyn), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    1605
  • Annotation
    This variant (3) uses an alternate in-frame exon in the coding region and differs in the 5' UTR compared to variant 1. It encodes an isoform (b) with a different and shorter internal segment compared to isoform a. Variants 2 and 3 encode the same isoform (b).
  • siRNA

    GGACAGGAGUGACACUGUUtt

    GGUUCACAAUCAAGUCUGAtt

    GGUGCGAAGUUUCCCAUUAtt

  • DataSheet:
  • DataSheet:
  • Product Name
    Fyn(NM_001122893) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus Fyn proto-oncogene (Fyn), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    1614
  • Annotation
    This variant (1) represents the longest transcript and encodes the longer isoform (a).
  • siRNA

    GGACAGGAGUGACACUGUUtt

    GGUUCACAAUCAAGUCUGAtt

    GGUGCGAAGUUUCCCAUUAtt

  • DataSheet:
  • Vector Name
    pCMV-SPORT6
  • primers
    T7: TAATACGACTCACTATAGGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4396
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    Vector for cloning and transient mammalian cell expression of cDNAs.
  • Vector Name
    pEXP-Entry
  • primers
    T7: TAATACGACTCACTATAGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4919
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    Myc,FLAG
  • Description
    ORFs cloned in this vector will be expressed in mammalian cellsas a tagged protein with the C-terminal Myc-FLAG tags.
    Such clones are the best for detection and purification of the transgene using anti-Myc or anti-FLAG antibodies.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"