NovoPro
Cart 2
  • FTO Pongo abelii  cDNA/ORF Clones

FTO Pongo abelii cDNA/ORF Clones

Cat.#: 719410-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 260.2 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    FTO, alpha-ketoglutarate dependent dioxygenase
  • Organism
    Pongo abelii
  • Entrez Gene ID
  • Gene Symbol
    FTO
  • Gene Type
    protein coding
  • Encoded Protein Alias
    Protein fatso; fat mass and obesity-associated protein; protein fto
  • Product Name
    FTO(NM_001132778) Pongo abelii cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Pongo abelii FTO, alpha-ketoglutarate dependent dioxygenase (FTO), mRNA.
  • Synonyms
  • ORF length
    1518
  • DataSheet:
  • Product Name
    FTO(XM_009250721) Pongo abelii cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Pongo abelii fat mass and obesity associated (FTO), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    1548
  • DataSheet:
  • Product Name
    FTO(XM_009250722) Pongo abelii cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Pongo abelii fat mass and obesity associated (FTO), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    1539
  • DataSheet:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"